fmt

168

methionyl-tRNA formyltransferase

Locus: BSU_15730

Molecular weight: 34.48 kDa

Isoelectric point: 5.62

Protein length: 317 aa

Gene length: 954 bp

Function: formylation of Met-tRNA(fMet)

Product: methionyl-tRNA formyltransferase

Essential: no

E.C.: 2.1.2.9

Synonyms: fmt, yloL

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0223 (Galperin et al., 2021)

Gene

Coordinates: 1,646,999  1,647,952

Phenotypes of a mutant

• the mutant tends to acquire suppressor mutations that result in improved growth PubMed
• inactivation of ''fmt suppresses the synthetic lethality of the defA defB'' double mutant PubMed
• essential according to Kobayashi et al. PubMed, but a deletion mutant was constructed by Cai et al. PubMed
• the mutant is defective for biofilm formation, motility, and sporulation  PubMed
• the mutant exhibits increased sensitivity to metal ion excess and oxidative stress PubMed

The protein

Catalyzed reaction/ biological activity

• (6S)-10-formyltetrahydrofolate + L-methionyl-tRNA^fMet --> (6S)-5,6,7,8-tetrahydrofolate + H⁺ + N-formyl-L-methionyl-tRNA^fMet (according to UniProt)

Protein family

• fmt family (single member, according to UniProt)

Structure

• 3RFO (PDB) (from Bacillus anthracis, 69% identity, 89% similarity)
• P94463 (AlphaFold)

Expression and Regulation

Operons

• Genes: defA-fmt-yloM-yloN

  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon

• Genes: yloC-remA-gmk-yloH-coaBC-priA-defA-fmt-yloM-yloN

  Description

  • PubMed

Additional information

• translation is likely to require Efp due to the presence of several consecutive proline residues PubMed

Biological materials

Mutant

• BKE15730 (fmt::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAAATACGATTCTCGTCA,  downstream forward: _UP4_GCCGGTGATGTGTTAGGAGT
• BKK15730 (fmt::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAAATACGATTCTCGTCA,  downstream forward: _UP4_GCCGGTGATGTGTTAGGAGT

References

Loading