cysH

cysH
168

phosphoadenosine phosphosulfate sulfotransferase

locus
BSU_15570
Molecular weight
26.83 kDa
pI
5.46
Protein length
Gene length
function
sulfate reduction
product
phosphoadenosine phosphosulfate sulfotransferase
essential
no
ec
1.8.4.8
synonyms
cysH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0175 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,630,382  1,631,083
The protein
Catalyzed reaction/ biological activity
[thioredoxin]-disulfide + adenosine 3',5'-bisphosphate + 2 H+ + sulfite --> 3'-phosphoadenylyl sulfate + [thioredoxin]-dithiol (according to UniProt)
Protein family
PAPS reductase family (with [protein|E5090587E23B284EF3B3D8F3EA5C44CB86EEB82E|yitB], according to UniProt)
Structure
[PDB|2GOY] (from ''Pseudomonas aeruginosa'', 35% identity) [Pubmed|17010373]
[AF|P94498]
Paralogous protein(s)
[protein|E5090587E23B284EF3B3D8F3EA5C44CB86EEB82E|yitB]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|51EB09C122A7166D662AE72842A44EC5FBA03134|cysH]-[gene|58A5A7F12664EC38AC21E24C1AD89671D7E648CF|cysP]-[gene|6CF2A9A517B641C44C0B46EF242BC5E668EA846B|sat]-[gene|3C71659E4868744A9301C26608EABF7B98217DCF|cysC]-[gene|92831D5A8E07A18BA6C6978123769D00D685BB45|ylnD]-[gene|9349C4646A56F933041EBE750F1BE86BAE7A60D9|sirB]-[gene|8BAB9B12D9D58A45446DC6CB7F48869089800FD3|ylnF]
description
[Pubmed|11004190]
regulation
induced by methionine starvation ([wiki|S-box]) [Pubmed|10094622]
the [wiki|S-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
regulatory mechanism
[protein|50930C56C27D22715620A350220E3C56ADB41020|cymR]: transcription repression, [pubmed|], in [regulon|protein:50930C56C27D22715620A350220E3C56ADB41020|cymR regulon]
S-box: RNA switch, , the [wiki|S-box] [wiki|riboswitch] binds S-adenosylmethionine resulting in termination [Pubmed|10094622], in [regulon|other_regulator:S-box|S-box]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|11004190], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|51EB09C122A7166D662AE72842A44EC5FBA03134|cysH]→[gene|8BAB9B12D9D58A45446DC6CB7F48869089800FD3|ylnF]

2025-10-28 00:15:54

Jstuelk

170

ee26ed9bec04d4ffdc2deea174a197c7290dfe30

AC610BA23AE4EE98F22EC54E46509E3060BAE285

Biological materials
Mutant
BKE15570 ([gene|51EB09C122A7166D662AE72842A44EC5FBA03134|cysH]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE15570 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTCTTTCCTCCTTT,  downstream forward: _UP4_CTGCATGAATAAGGAGCTGC
BKK15570 ([gene|51EB09C122A7166D662AE72842A44EC5FBA03134|cysH]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK15570 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTCTTTCCTCCTTT,  downstream forward: _UP4_CTGCATGAATAAGGAGCTGC
labs
[[Isabelle Martin-Verstraete]], Institute Pasteur, Paris, France
References
10094622,16267287,11004190,12107147,18039762,9006060,17010373,29794222

51EB09C122A7166D662AE72842A44EC5FBA03134

Page visits: 7644

Time of last update: 2025-10-27 06:32:25

Author of last update: Melvin.boenninger