hypR

168

MarR/DUF24 family transcription regulator, positively controls the nitroreductase gene hypO in response to disulfide stress

Locus: BSU_40540

Molecular weight: 14.59 kDa

Isoelectric point: 8.41

Protein length: 125 aa

Gene length: 378 bp

Function: control of the nitroreductase gene hypO in response to disulfide stress (diamide, NaOCl)

Product: MarR/DUF24 family transcription regulator HypR

Essential: no

Synonyms: hypR, yybR

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1733 (Galperin et al., 2021)

Gene

Coordinates: 4,167,622  4,167,999

The protein

Protein family

• MarR/DUF24 family

Domains

• 5 alpha helices, 2 beta sheets, MarR-fold with wHTH motif, alpha4 major groove recognition helix, beta2 and 3 form the wing; alpha5 dimer interface PubMed
• HTH hxlR-type domain (aa 14-112) (according to UniProt)

Structure

• 4A5N (PDB) (reduced HypRC14S dimer) PubMed
• 4A5M (PDB) (oxidized HypR C14-C49' intersubunit disulfide-linked dimer ) PubMed
• P37486 (AlphaFold)

Modification

• oxidized to Cys14-Cys49' intersubunit disulfides by disulfide stress PubMed
• Cys14 and Cys49' are about 8-9 Angstrm apart in reduced HypR-Dimer, oxidation moves the major groove recognition alpha4 helices of the HypR dimer about 4 Angstroem towards each other that leads to activation of HypR PubMed

Kinetic information

• Cys14 redox sensing Cys, has lower pKa of 6.36 PubMed

Paralogous protein(s)

• YkvN, HxlR, YdzF, YdeP, YtcD, YodB

Localization

• cytoplasmic

Expression and Regulation

Operons

• Genes: hypR

  Description: PubMed

  Regulation

  • activated by disulfide stress conditions (diamide, NaOCl) in vivo and in vitro (autoregulation) PubMed

  Regulatory mechanism

  • HypR: activation, (autoregulation)PubMed, in hypR regulon

Biological materials

Mutant

• MGNA-B836 (yybR::erm), available at the NBRP B. subtilis, Japan
• BKE40540 (hypR::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTCTTGACCCTCCAATAG,  downstream forward: _UP4_TAGCAGCAAAGGGAACTCCT
• BKK40540 (hypR::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTCTTGACCCTCCAATAG,  downstream forward: _UP4_TAGCAGCAAAGGGAACTCCT

Labs working on this gene/protein

• Haike Antelmann,University of Greifswald, Germany