gapB

168

glyceraldehyde-3-phosphate dehydrogenase, NADP-dependent, gluconeogenic enzyme, forms a transhydrogenation cycle with GapA for balancing of NADPH

Locus: BSU_29020

Molecular weight: 37.32 kDa

Isoelectric point: 6.45

Protein length: 340 aa

Gene length: 1023 bp

Function: anabolic enzyme in gluconeogenesis

Product: glyceraldehyde-3-phosphate dehydrogenase 2

Essential: no

E.C.: 1.2.1.59

Synonyms: gapB

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0057 (Galperin et al., 2021)

Gene

Coordinates: 2,967,032 → 2,968,054

Phenotypes of a mutant

• inactivation of ''gapB'' reduces sporulation efficiency to 0.3% that of wild type cells; delayed entry into sporulation and fewer sporulating cells PubMed

The protein

Catalyzed reaction/ biological activity

• D-glyceraldehyde3-P + NADP⁺ + phosphate --> 1,3-bisphosphoglycerate + H⁺ + NADPH(according to UniProt)
• This reaction is part of the gluconeogenesis

Protein family

• glyceraldehyde-3-phosphate dehydrogenase family (with GapA, according to UniProt)

Domains

• Nucleotid bindinge domain (12-13)
• 2x glyceraldehyde-3-P binding domain (151-153) & (210-211)

Cofactors

• NADP⁺ (preferentially) and NAD⁺ PubMed

Structure

• 3PRL (PDB) (from B. halodurans)
• O34425 (AlphaFold)

Kinetic information

• Michaelis-Menten PubMed

Paralogous protein(s)

• GapA

Localization

• Cytoplasm (Homogeneous) PubMed

Additional information

• aggregates at elevated temperatures, aggregation is prevented by interaction with YjoB PubMed

Expression and Regulation

Operons

• Genes: gapB-speD

  Description: PubMed

  Regulation

  • gapB: repressed in the presence of glucose (CcpN) PubMed

  Regulatory mechanism

  • CcpN: repression, PubMed, in ccpN regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon

  Additional information

  • speD: the mRNA is substantially stabilized upon depletion of RNase Y (the half-life of the monocistronic speD mRNA increases from 1.4 to 36 min) PubMed

Biological materials

Mutant

• MGNA-A121 (gapB::erm), available at the NBRP B. subtilis, Japan
• GP701 (gapB::spec), available in Stülke lab
• 1A1004 ( gapB::erm), PubMed, available at BGSC
• BKE29020 (ΔgapB::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGTTGGACACCCCTTATC,  downstream forward: _UP4_TAAAATAAGGTCATGGACAC
• BKK29020 (ΔgapB::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGTTGGACACCCCTTATC,  downstream forward: _UP4_TAAAATAAGGTCATGGACAC

LacZ fusion

• pGP3312 (p_gapB-lacZ cat), GP1679, available in Jörg Stülke's lab

Labs working on this gene/protein

• Stephane Aymerich, Microbiology and Molecular Genetics, INRA Paris-Grignon, France

References

Loading