yrpB

168

similar to 2-nitropropane dioxygenase

Locus: BSU_26800

Molecular weight: 37.91 kDa

Isoelectric point: 5.26

Protein length: 347 aa

Gene length: 1044 bp

Function: unknown

Product: unknown

Essential: no

Synonyms: yrpB

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG2070 (Galperin et al., 2021)

Gene

Coordinates: 2,736,915  2,737,958

The protein

Catalyzed reaction/ biological activity

• H₂O + 3 O₂ + 3 propionate 3-nitronate --> 3 3-oxopropanoate + 3 H⁺ + H₂O₂ + 2 nitrate + nitrite (according to UniProt)

Protein family

• nitronate monooxygenase family (single member, according to UniProt)

Structure

• 4QIS (PDB) (from Pseudomonas Aeruginosa 36% identity)
• O05413 (AlphaFold)

Expression and Regulation

Operons

• Genes: yrpB

  Description: PubMed

Biological materials

Mutant

• MGNA-A866 (yrpB::erm), available at the NBRP B. subtilis, Japan
• BKE26800 (yrpB::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATACCGAATCCTCCCGTTA,  downstream forward: _UP4_TAGGCGCACCTCATTGATAG
• BKK26800 (yrpB::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATACCGAATCCTCCCGTTA,  downstream forward: _UP4_TAGGCGCACCTCATTGATAG