tuaC

168

sugar transferase

Locus: BSU_35590

Molecular weight: 43.12 kDa

Isoelectric point: 9.75

Protein length: 389 aa

Gene length: 1170 bp

Function: biosynthesis of teichuronic acid

Product: sugar transferase

Essential: no

Synonyms: tuaC, yvhC

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Cellular processes, Cell envelope and cell division, Cell wall synthesis, Biosynthesis of teichuronic acid

Metabolism, Additional metabolic pathways, Biosynthesis of cell wall components, Biosynthesis of teichuronic acid

List of homologs in different organisms, belongs to COG0438 (Galperin et al., 2021)

This gene is a member of the following regulons

SigA regulon, SigF regulon, PhoP regulon

Gene

Coordinates: 3,655,586  3,656,755

The protein

Protein family

glycosyltransferase 1 family (according to UniProt)
Glycosyltransferase 4 subfamily (according to UniProt)

Structure

3C48 (PDB) (from Corynebacterium glutamicum, 27% identity) PubMed
O32272 (AlphaFold)

Expression and Regulation

Operons

Genes: tuaA/2-tuaA/1-tuaB-tuaC-tuaD-tuaE-tuaF-tuaG-tuaH

Description: PubMed

Regulation

expressed during sporulation in the forespore (SigF) PubMed

Regulatory mechanism

PhoP: activation, PubMed, in phoP regulon

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon
SigF: sigma factor, PubMed, in sigF regulon

Biological materials

Mutant

BKE35590 (tuaC::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CTTCATGACAAACGTCCTTT,  downstream forward: _UP4_TAATCGTAAGACACTGCGAC
BKK35590 (tuaC::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CTTCATGACAAACGTCCTTT,  downstream forward: _UP4_TAATCGTAAGACACTGCGAC

References

Loading