racX

168

amino acid racemase, production of non-canonical D-amino acids

Locus: BSU_34430

Molecular weight: 25.14 kDa

Isoelectric point: 5.4

Protein length: 227 aa

Gene length: 684 bp

Function: production of non-canonical D-amino acids

Product: amino acid racemase

Essential: no

Synonyms: racX

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Lifestyles, Coping with stress, Cell envelope stress proteins (controlled by SigM, V, W, X, Y)

List of homologs in different organisms, belongs to COG1794 (Galperin et al., 2021)

Gene

Coordinates: 3,533,419  3,534,102

The protein

Catalyzed reaction/ biological activity

L-α-amino acid --> D-α-amino acid (according to UniProt)
LL-2,6-diaminoheptanedioate --> meso-2,6-diaminopimelate(according to UniProt)
L-lysine --> D-lysine (according to UniProt)
L-arginine --> D-arginine (according to UniProt)
L-ornithine --> D-ornithine (according to UniProt)
L-histidine --> D-histidine (according to UniProt)
L-alanine --> D-alanine (according to UniProt)
L-tyrosine --> D-tyrosine (according to UniProt)
L-phenylalanine --> D-phenylalanine (according to UniProt)
L-serine --> D-serine (according to UniProt)
L-glutamine --> D-glutamine (according to UniProt)
L-methionine --> D-methionine (according to UniProt)
L-asparagine --> D-asparagine (according to UniProt)
L-homoserine --> D-homoserine (according to UniProt)

Protein family

aspartate/glutamate racemases family (with RacE and YrpC, according to UniProt)

Structure

1JFL (PDB) (from Pyrococcus horikoshii, 30% identity) PubMed
P32960 (AlphaFold)

Expression and Regulation

Operons

Genes: pbpE-racX

Description: PubMed

Regulation

induced by cell wall stress (SigW) PubMed

Sigma factors

SigW: sigma factor, PubMed, in sigW regulon

Biological materials

Mutant

GP3650 (ΔracX::aphA3), available in Jörg Stülke's lab
BKE34430 (racX::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_TCCGATCATCAAATTCATTC,  downstream forward: _UP4_TAGCTTCAGACAAGGACTGT
BKK34430 (racX::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_TCCGATCATCAAATTCATTC,  downstream forward: _UP4_TAGCTTCAGACAAGGACTGT

Expression vectors

pGP3816 (expression of RacX in pBQ200), available in Jörg Stülke's lab

References

Loading