prpE

168

protein tyrosine phosphatase

Locus: BSU_11630

Molecular weight: 27.31 kDa

Isoelectric point: 6.75

Protein length: 244 aa

Gene length: 735 bp

Function: unknown

Product: protein tyrosine phosphatase

Essential: no

E.C.: 3.6.1.17

Synonyms: prpE, yjbP

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Information processing, Protein synthesis, modification and degradation, Protein modification, Protein phosphatases

List of homologs in different organisms

Gene

Coordinates: 1,239,387 → 1,240,121

Phenotypes of a mutant

increased amounts of small aci-soluble spore proteins (SASPs) PubMed

The protein

Catalyzed reaction/ biological activity

H₂O + P¹,P⁴-bis(5'-adenosyl) tetraphosphate --> AMP + ATP + 2 H⁺PubMed
H₂O + P¹,P⁴-bis(5'-guanosyl) tetraphosphate --> GMP + GTP + 2 H⁺ (according to UniProt)

Protein family

prpE family (single member, according to UniProt)

Structure

4J6O (PDB) (PnkP from Thermocellum sp., 48% identity) PubMed
O31614 (AlphaFold)

Localization

forespore (according to Swiss-Prot)

Expression and Regulation

Operons

Genes: prpE

Description: PubMed

Biological materials

Mutant

MGNA-B162 (yjbP::erm), available at the NBRP B. subtilis, Japan
BKE11630 (ΔprpE::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGCGGTCTCCTCCTTACC,  downstream forward: _UP4_CGCCCCATATAAAAAAGGAG
BKK11630 (ΔprpE::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGCGGTCTCCTCCTTACC,  downstream forward: _UP4_CGCCCCATATAAAAAAGGAG

References

Reviews

Young MK, Wang JDFrom dusty shelves toward the spotlight: growing evidence for Ap4A as an alarmone in maintaining RNA stability and proteostasis.Current opinion in microbiology. 2024 Aug 30; 81:102536. PMID: 39216180

Original Publications

Iwanicki A, Hinc K, Ronowicz A, Piotrowski A, Wołoszyk A, Obuchowski M A genome-wide transcriptional profiling of sporulating Bacillus subtilis strain lacking PrpE protein phosphatase. Molecular genetics and genomics : MGG. 2013 Oct; 288(10):469-81. doi:10.1007/s00438-013-0763-7. PMID:23824080
Wang LK, Smith P, Shuman S Structure and mechanism of the 2',3' phosphatase component of the bacterial Pnkp-Hen1 RNA repair system. Nucleic acids research. 2013 Jun; 41(11):5864-73. doi:10.1093/nar/gkt221. PMID:23595150
Nicolas P, Mäder U, Dervyn E, Rochat T, Leduc A, Pigeonneau N, Bidnenko E, Marchadier E, Hoebeke M, Aymerich S, Becher D, Bisicchia P, Botella E, Delumeau O, Doherty G, Denham EL, Fogg MJ, Fromion V, Goelzer A, Hansen A, Härtig E, Harwood CR, Homuth G, Jarmer H, Jules M, Klipp E, Le Chat L, Lecointe F, Lewis P, Liebermeister W, March A, Mars RA, Nannapaneni P, Noone D, Pohl S, Rinn B, Rügheimer F, Sappa PK, Samson F, Schaffer M, Schwikowski B, Steil L, Stülke J, Wiegert T, Devine KM, Wilkinson AJ, van Dijl JM, Hecker M, Völker U, Bessières P, Noirot P Condition-dependent transcriptome reveals high-level regulatory architecture in Bacillus subtilis. Science (New York, N.Y.). 2012 Mar 02; 335(6072):1103-6. doi:10.1126/science.1206848. PMID:22383849
Macur K, Temporini C, Massolini G, Grzenkowicz-Wydra J, Obuchowski M, Bączek T Proteomic analysis of small acid soluble proteins in the spore core of Bacillus subtilis ΔprpE and 168 strains with predictions of peptides liquid chromatography retention times as an additional tool in protein identification. Proteome science. 2010 Nov 22; 8:60. doi:10.1186/1477-5956-8-60. PMID:21092197
Hinc K, Nagórska K, Iwanicki A, Wegrzyn G, Séror SJ, Obuchowski M Expression of genes coding for GerA and GerK spore germination receptors is dependent on the protein phosphatase PrpE. Journal of bacteriology. 2006 Jun; 188(12):4373-83. . PMID:16740944
Iwanicki A, Herman-Antosiewicz A, Pierechod M, Séror SJ, Obuchowski M PrpE, a PPP protein phosphatase from Bacillus subtilis with unusual substrate specificity. The Biochemical journal. 2002 Sep 15; 366(Pt 3):929-36. . PMID:12059787