cspB

168

major cold-shock protein

Locus: BSU_09100

Molecular weight: 7.23 kDa

Isoelectric point: 4.34

Protein length: 67 aa

Gene length: 204 bp

Function: RNA chaperone

Product: major cold-shock protein

Essential: no

Synonyms: cspB

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1278 (Galperin et al., 2021)

Gene

Coordinates: 984,262 984,465

Phenotypes of a mutant

• elongated cells in the stationary phase PubMed
• cspB cspD double mutants are poorly viable, rapidly acquire suppressor mutations that result in overexpression of cspC or loss of the veg gene PubMed
• cspB cspD double mutants have lost genetic competence PubMed
• cspB cspC double mutants are poorly viable at 15°C PubMed

The protein

Domains

• CSD domain (aa 4-63) (according to UniProt)

Structure

• 2I5M (PDB) PubMed
• 2ES2 (PDB) PubMed
• 1CSP (PDB) PubMed
• 1NMG (PDB) (NMR)
• 3PF4 (PDB) (in complex with r(GUCUUUA)) PubMed
• P32081 (AlphaFold)

Paralogous protein(s)

• CspC, CspD

Localization

• cytoplasm (according to Swiss-Prot), cytoplasma, colocalizes with the ribosomes PubMed

Additional information

• subject to Clp-dependent proteolysis upon glucose starvation PubMed
• belongs to the 100 most abundant proteins PubMed

Expression and Regulation

Operons

• Genes: cspB

  Description: PubMed

  Regulation

  • strong constitutive expression PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon

Biological materials

Mutant

• GP1968 (cspB::cat trpC2) available in Jörg Stülke's lab PubMed
• GP3251 (cspB::tet trpC2) available in Jörg Stülke's lab
• BKE09100 (cspB::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGAAATTTCCTCCTAAAG, downstream forward: _UP4_TAAGCATAAATTGATATGAA
• BKK09100 (cspB::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGAAATTTCCTCCTAAAG, downstream forward: _UP4_TAAGCATAAATTGATATGAA

Expression vectors

• pGP3140: Expression of 6XHIS-SUMO-tagged cspB by pETSUMOadapt in E. coli, available in Jörg Stülke's lab

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab

LacZ fusion

• GP3283 (cspB::lacZ cat, based on pAC5), available in Jörg Stülke's lab PubMed

Labs working on this gene/protein

• Mohamed Marahiel, Marburg University, Germany homepage

Reviews

Original Publications

Loading