comEB

168

dCMP deaminase, late competence protein, nucleotide scavenging protein for efficient reutilization of the products of degradation of the non-transforming strand during DNA uptake

Locus: BSU_25580

Molecular weight: 20.82 kDa

Isoelectric point: 5.37

Protein length: 189 aa

Gene length: 570 bp

Function: nucleotide scavenging

Product: dCMP deaminase

Essential: no

Synonyms: comEB, comD

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Information processing, Genetics, Genetic competence

Lifestyles, Exponential and early post-exponential lifestyles, Genetic competence

List of homologs in different organisms, belongs to COG2131 (Galperin et al., 2021)

Gene

Coordinates: 2,639,877  2,640,446

The protein

Catalyzed reaction/ biological activity

deoxycytidylate monophosphate (dCMP) deaminase PubMed
nucleotide scavenging protein for efficient reutilization of the products of degradation of the non-transforming strand during DNA uptake PubMed

Protein family

Cytidine and deoxycytidylate deaminase family (according to UniProt)

Domains

CMP/dCMP-type deaminase domain (aa 5–132) (according to UniProt)

Structure

2HVV (PDB) (from Streptococcus mutans, 50% identity) PubMed
P32393 (AlphaFold)

Localization

localizes to one or both cell poles PubMed

Expression and Regulation

Operons

Genes: comEA-comEB-comEC

Description: PubMed

Regulatory mechanism

ComK: activation, PubMed, in comK regulon

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon

Other regulations

ComN: unknown, PubMed

Biological materials

Mutant

BKE25580 (comEB::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACGTTGTTCCCTCCAAATG,  downstream forward: _UP4_CTTTTCACGAGCTACGTGTG
BKK25580 (comEB::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACGTTGTTCCCTCCAAATG,  downstream forward: _UP4_CTTTTCACGAGCTACGTGTG

References

Loading