asnH

168

asparagine synthetase (glutamine-hydrolysing)

Locus: BSU_39920

Molecular weight: 85.66 kDa

Isoelectric point: 5.53

Protein length: 747 aa

Gene length: 2244 bp

Function: biosynthesis of asparagine

Product: asparagine synthetase (glutamine-hydrolysing)

Essential: no

E.C.: 6.3.5.4

Synonyms: asnH, yxaN

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Metabolism, Amino acid/ nitrogen metabolism, Biosynthesis/ acquisition of amino acids, Biosynthesis/ acquisition of aspartate/ asparagine

List of homologs in different organisms, belongs to COG0367 (Galperin et al., 2021)

This gene is a member of the following regulons

SigA regulon, CodY regulon, AbrB regulon

Gene

Coordinates: 4,098,926  4,101,169

The protein

Catalyzed reaction/ biological activity

ATP + H₂O + L-aspartate + L-glutamine --> AMP + diphosphate + H⁺ + L-asparagine + L-glutamate (according to UniProt)

Protein family

asparagine synthetase family (with AsnB and AsnO, according to UniProt)

Domains

Glutamine amidotransferase type-2 domain (aa 2-218) (according to UniProt)

Structure

1CT9 (PDB) (from E. coli, corresponds to aa 30 ... 537, 27% identity) PubMed
P42113 (AlphaFold)

Expression and Regulation

Operons

Genes: yxbB-yxbA-yxnB-asnH-yxaM

Description: PubMed

Regulation

repressed by glucose (8-fold) PubMed

Regulatory mechanism

CodY: repression, PubMed, in codY regulon
AbrB: repression, PubMed, in abrB regulon

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon

Biological materials

Mutant

GP4146 (asnH::ermC), available in  Jörg Stülke's lab
MGNA-B689 (asnH::erm), available at the NBRP B. subtilis, Japan
BKE39920 (asnH::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATATGTCTCCCTCCCAATA,  downstream forward: _UP4_AATCTGCCAGAAGGAGCATA
BKK39920 (asnH::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATATGTCTCCCTCCCAATA,  downstream forward: _UP4_AATCTGCCAGAAGGAGCATA

References

Reviews

Raushel FM, Thoden JB, Holden HM Enzymes with molecular tunnels. Accounts of chemical research. 2003 Jul; 36(7):539-48. . PMID:12859215
Huang X, Holden HM, Raushel FM Channeling of substrates and intermediates in enzyme-catalyzed reactions. Annual review of biochemistry. 2001; 70:149-80. . PMID:11395405

Original Publications

Morinaga T, Kobayashi K, Ashida H, Fujita Y, Yoshida K Transcriptional regulation of the Bacillus subtilis asnH operon and role of the 5'-proximal long sequence triplication in RNA stabilization. Microbiology (Reading, England). 2010 Jun; 156(Pt 6):1632-41. doi:10.1099/mic.0.036582-0. PMID:20185509
Hamon MA, Stanley NR, Britton RA, Grossman AD, Lazazzera BA Identification of AbrB-regulated genes involved in biofilm formation by Bacillus subtilis. Molecular microbiology. 2004 May; 52(3):847-60. . PMID:15101989
Molle V, Nakaura Y, Shivers RP, Yamaguchi H, Losick R, Fujita Y, Sonenshein AL Additional targets of the Bacillus subtilis global regulator CodY identified by chromatin immunoprecipitation and genome-wide transcript analysis. Journal of bacteriology. 2003 Mar; 185(6):1911-22. . PMID:12618455
Molle V, Nakaura Y, Shivers RP, Yamaguchi H, Losick R, Fujita Y, Sonenshein AL Additional targets of the Bacillus subtilis global regulator CodY identified by chromatin immunoprecipitation and genome-wide transcript analysis. Journal of bacteriology. 2003 Mar; 185(6):1911-22. . PMID:12618455
Yoshida K, Ishio I, Nagakawa E, Yamamoto Y, Yamamoto M, Fujita Y Systematic study of gene expression and transcription organization in the gntZ-ywaA region of the Bacillus subtilis genome. Microbiology (Reading, England). 2000 Mar; 146 ( Pt 3):573-9. . PMID:10746760
Larsen TM, Boehlein SK, Schuster SM, Richards NG, Thoden JB, Holden HM, Rayment I Three-dimensional structure of Escherichia coli asparagine synthetase B: a short journey from substrate to product. Biochemistry. 1999 Dec 07; 38(49):16146-57. . PMID:10587437
Yoshida K, Fujita Y, Ehrlich SD Three asparagine synthetase genes of Bacillus subtilis. Journal of bacteriology. 1999 Oct; 181(19):6081-91. . PMID:10498721