asnH

asnH
168

asparagine synthetase (glutamine-hydrolysing)

locus
BSU_39920
Molecular weight
85.66 kDa
pI
5.53
Protein length
Gene length
function
biosynthesis of asparagine
product
asparagine synthetase (glutamine-hydrolysing)
essential
no
ec
6.3.5.4
synonyms
asnH, yxaN

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0367 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
4,098,926  4,101,169
The protein
Catalyzed reaction/ biological activity
ATP + H2O + L-aspartate + L-glutamine --> AMP + diphosphate + H+ + L-asparagine + L-glutamate (according to UniProt)
Protein family
asparagine synthetase family (with [protein|6F5BBCBA02EA1C016AA37EB63D252A4C07CE6617|asnB] and [protein|15D150B53A25325DBC414F0C2B0D44AEF4B115A9|asnO], according to UniProt)
[wiki|Domains]
[wiki|Glutamine amidotransferase type-2 domain] (aa 2-218) (according to UniProt)
Structure
[PDB|1CT9] (from E. coli, corresponds to aa 30 ... 537, 27% identity) [pubmed|10587437]
[AF|P42113]
Expression and Regulation
Operons
genes
[gene|787BB72119DB1321A8281D7C46FED28CAEDBC97C|yxbB]-[gene|88B01CC87394AEE693A98574F9343EBF99F0D60E|yxbA]-[gene|A15368CD02487EBC1AF999FED34672E38167BCB2|yxnB]-[gene|9446D9C88CBBBC5A08495D8AA49A92A9F47F2C9B|asnH]-[gene|BF0E188249161B3CC24D223FDD48B820EBED8F55|yxaM]
description
[Pubmed|10746760]
regulation
repressed by glucose (8-fold) [Pubmed|12850135]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|12618455], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|15101989], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|20185509], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|787BB72119DB1321A8281D7C46FED28CAEDBC97C|yxbB]→[gene|BF0E188249161B3CC24D223FDD48B820EBED8F55|yxaM]

2025-10-22 17:56:07

ghost

136

b92c3bd2849e2809ddcc3c320eae6fb9d682a8b4

5C58E2063585752CCDF4E84423501D1D48511254

Biological materials
Mutant
GP4146 (''asnH''::''ermC''), available in  [wiki|Jörg Stülke]'s lab
MGNA-B689 (asnH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1688 NBRP B. subtilis, Japan]
BKE39920 ([gene|9446D9C88CBBBC5A08495D8AA49A92A9F47F2C9B|asnH]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE39920 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATGTCTCCCTCCCAATA,  downstream forward: _UP4_AATCTGCCAGAAGGAGCATA
BKK39920 ([gene|9446D9C88CBBBC5A08495D8AA49A92A9F47F2C9B|asnH]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK39920 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATGTCTCCCTCCCAATA,  downstream forward: _UP4_AATCTGCCAGAAGGAGCATA
References
Reviews
12859215,11395405
Original Publications
20185509,10746760,12618455,10498721,12618455,15101989,10587437

9446D9C88CBBBC5A08495D8AA49A92A9F47F2C9B

Page visits: 4620

Time of last update: 2025-10-27 20:28:53

Author of last update: Jstuelk