pckA

168

phosphoenolpyruvate carboxykinase

Locus: BSU_30560

Molecular weight: 58.13 kDa

Isoelectric point: 5.12

Protein length: 527 aa

Gene length: 1584 bp

Function: synthesis of phosphoenolpyruvate

Product: phosphoenolpyruvate carboxykinase

Essential: no

E.C.: 4.1.1.49

Synonyms: pckA

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Metabolism, Carbon metabolism, Carbon core metabolism, Gluconeogenesis

List of homologs in different organisms, belongs to COG1866 (Galperin et al., 2021)

This gene is a member of the following regulons

SigA regulon, CcpN regulon

Gene

Coordinates: 3,129,530  3,131,113

The protein

Catalyzed reaction/ biological activity

ATP + oxaloacetate --> ADP + CO₂ + phosphoenolpyruvate (according to UniProt)

Protein family

phosphoenolpyruvate carboxykinase (ATP) family (single member, according to UniProt)

Domains

Nucleotide binding Domain (233240)

Structure

1J3B (PDB) (from Thermus thermophilus, 55.1% identity) PubMed
P54418 (AlphaFold)

Localization

cytoplasm (according to Swiss-Prot),  cytoplasm

Additional information

PckA is degraded in the forespore using MdfA as the adaptor protein PubMed

Expression and Regulation

Operons

Genes: pckA

Description: PubMed

Regulation

repressed by glucose (35-fold) CcpN PubMed

Regulatory mechanism

CcpN: repression, PubMed, in ccpN regulon

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon

Biological materials

Mutant

1A1005 ( pckA::spec), PubMed, available at BGSC
1A996 ( pckA::spec), PubMed, available at BGSC
GP1147 (pckA::neo), available in Jörg Stülke's lab
BKE30560 (pckA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATATGAAACCTTCCTTTAT,  downstream forward: _UP4_TAAAAAACAAAAGCCAAGAG
BKK30560 (pckA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATATGAAACCTTCCTTTAT,  downstream forward: _UP4_TAAAAAACAAAAGCCAAGAG

Expression vectors

pGP1753 (N-terminal Strep-tag, for SPINE, purification from B. subtilis, in pGP380) (available in Jörg Stülke's lab) PubMed
pGP1762 (for expression, purification in E. coli with N-terminal His-tag, in pWH844, available in Jörg Stülke's lab)
pGP1763 (for expression, purification in E. coli with N-terminal Strep-tag, in pGP172, available in Jörg Stülke's lab)

Two-hybrid system

B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab

FLAG-tag construct

GP1129 (spc, based on pGP1331), available in Jörg Stülke's lab PubMed

LacZ fusion

pGP3312 (cat, based on pAC5), available in Jörg Stülke's lab

GFP fusion

GP1430 (spc, based on pGP1870), available in Jörg Stülke's lab

Labs working on this gene/protein

Stephane Aymerich, Microbiology and Molecular Genetics, INRA Paris-Grignon, France

References

Riley EP, Lyda JA, Reyes-Matte O, Sugie J, Kasu IR, Enustun E, Armbruster E, Ravishankar S, Isaacson RL, Camp AH, Lopez-Garrido J, Pogliano KDevelopmentally-regulated proteolysis by MdfA and ClpCP mediates metabolic differentiation during Bacillus subtilis sporulation.bioRxiv : the preprint server for biology. 2024 Nov 26; . PMID: 39651166
O'Reilly FJ, Graziadei A, Forbrig C, Bremenkamp R, Charles K, Lenz S, Elfmann C, Fischer L, Stülke J, Rappsilber JProtein complexes in cells by AI-assisted structural proteomics.Molecular systems biology. 2023 Feb 23; :e11544. PMID: 36815589
Meyer FM, Stülke J Malate metabolism in Bacillus subtilis: distinct roles for three classes of malate-oxidizing enzymes. FEMS microbiology letters. 2013 Feb; 339(1):17-22. doi:10.1111/1574-6968.12041. PMID:23136871
Ferguson ML, Le Coq D, Jules M, Aymerich S, Radulescu O, Declerck N, Royer CA Reconciling molecular regulatory mechanisms with noise patterns of bacterial metabolic promoters in induced and repressed states. Proceedings of the National Academy of Sciences of the United States of America. 2012 Jan 03; 109(1):155-60. doi:10.1073/pnas.1110541108. PMID:22190493
Meyer FM, Gerwig J, Hammer E, Herzberg C, Commichau FM, Völker U, Stülke J Physical interactions between tricarboxylic acid cycle enzymes in Bacillus subtilis: evidence for a metabolon. Metabolic engineering. 2011 Jan; 13(1):18-27. doi:10.1016/j.ymben.2010.10.001. PMID:20933603
Tännler S, Fischer E, Le Coq D, Doan T, Jamet E, Sauer U, Aymerich S CcpN controls central carbon fluxes in Bacillus subtilis. Journal of bacteriology. 2008 Sep; 190(18):6178-87. doi:10.1128/JB.00552-08. PMID:18586936
Sugahara M, Ohshima N, Ukita Y, Sugahara M, Kunishima NStructure of ATP-dependent phosphoenolpyruvate carboxykinase from Thermus thermophilus HB8 showing the structural basis of induced fit and thermostability.Acta crystallographica. Section D, Biological crystallography. 2005 Nov; 61(Pt 11):1500-7. PMID: 16239727
Servant P, Le Coq D, Aymerich S CcpN (YqzB), a novel regulator for CcpA-independent catabolite repression of Bacillus subtilis gluconeogenic genes. Molecular microbiology. 2005 Mar; 55(5):1435-51. . PMID:15720552
Blencke HM, Homuth G, Ludwig H, Mäder U, Hecker M, Stülke J Transcriptional profiling of gene expression in response to glucose in Bacillus subtilis: regulation of the central metabolic pathways. Metabolic engineering. 2003 Apr; 5(2):133-49. . PMID:12850135
Lapidus A, Galleron N, Sorokin A, Ehrlich SD Sequencing and functional annotation of the Bacillus subtilis genes in the 200 kb rrnB-dnaB region. Microbiology (Reading, England). 1997 Nov; 143 ( Pt 11):3431-41. . PMID:9387221