yjoB

168

putative substrate-specific molecular chaperone, prevents GapB and KatA from aggregation at elevated temperatures, AAA family, ATPase activity , similar to cell-division protein FtsH

Locus: BSU_12420

Molecular weight: 48.61 kDa

Isoelectric point: 4.73

Protein length: 423 aa

Gene length: 1272 bp

Function: unknown

Product: putative substrate-specific molecular chaperone

Essential: no

Synonyms: yjoB

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0465 (Galperin et al., 2021)

Gene

Coordinates: 1,314,453 → 1,315,724

The protein

Protein family

• AAA ATPase family (according to UniProt)

Structure

• 7W42 (PDB) PubMed
• 7W43 (PDB) (N-terminal domain) PubMed
• 7W46 (PDB) (complex with ADP) PubMed
• 1LV7 (PDB) (AAA domain of E. coli FtsH, correponds to aa 210 ... 400 of YjoB, 32% identity) PubMed
• O34703 (AlphaFold)

Paralogous protein(s)

• FtsH

Expression and Regulation

Operons

• Genes: yjoB

  Description: PubMed

  Sigma factors

  • SigW: sigma factor, PubMed, in sigW regulon

Biological materials

Mutant

• GP3785 (ΔyjoB::neo) available in Jörg Stülke's lab
• MGNA-A031 (yjoB::erm), available at the NBRP B. subtilis, Japan
• BKE12420 (ΔyjoB::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGTTTATACTCCATTTCA,  downstream forward: _UP4_TAAAAGAAAGCACGGGTGTT
• BKK12420 (ΔyjoB::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGTTTATACTCCATTTCA,  downstream forward: _UP4_TAAAAGAAAGCACGGGTGTT

Expression vectors

• pGP3828: expression of Strep-yjoB by pGP380 in B. subtilis suitable for SPINE, available in Jörg Stülke's lab
• pGP3829: expression of yjoB-Strep by pGP382 in B. subtilis suitable for SPINE, available in Jörg Stülke's lab
• pGP3834 (N-terminal Strep-tag, purification from E. coli, in pGP172), available in Jörg Stülke's lab
• pGP3923: expression of yjoB by pBQ200 in B. subtilis, available in Jörg Stülke's lab

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab

References

Loading