yvrD

168

similar to ketoacyl-carrier protein reductase

Locus: BSU_33190

Molecular weight: 28.07 kDa

Isoelectric point: 4.68

Protein length: 263 aa

Gene length: 792 bp

Function: unknown

Product: unknown

Essential: no

Synonyms: yvrD

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Groups of genes, Poorly characterized/ putative enzymes

List of homologs in different organisms, belongs to COG1028 (Galperin et al., 2021)

Gene

Coordinates: 3,404,835  3,405,626

The protein

Protein family

Short-chain dehydrogenases/reductases (SDR) family (according to UniProt)

Structure

3T4X (PDB) (YvaG from B. anthracis, 45% identity, 73% similarity)
O34782 (AlphaFold)

Paralogous protein(s)

YvaG, YhdF
BacC, (32,1%)

Expression and Regulation

Operons

Genes: yvrD

Description: PubMed

Biological materials

Mutant

MGNA-B046 (yvrD::erm), available at the NBRP B. subtilis, Japan
BKE33190 (yvrD::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAAGAATCATTCCTTTTG,  downstream forward: _UP4_TAGTATAAAAAAACGCATCC
BKK33190 (yvrD::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAAGAATCATTCCTTTTG,  downstream forward: _UP4_TAGTATAAAAAAACGCATCC