tyrA

tyrA
168

prephenate dehydrogenase

locus
BSU_22610
Molecular weight
41.28 kDa
pI
5.47
Protein length
Gene length
function
biosynthesis of tyrosine
product
prephenate dehydrogenase
essential
no
ec
1.3.1.12
synonyms
tyrA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0287 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
2,369,251 → 2,370,366
The protein
Catalyzed reaction/ biological activity
Prephenate + NAD+ --> 4-hydroxyphenylpyruvate + CO2 + NADH (according to UniProt)
Protein family
prephenate/arogenate dehydrogenase family (single member, according to UniProt)
[wiki|Domains]
Prephenate/arogenate dehydrogenase domain (aa 6-295) (according to UniProt)
[wiki|ACT domain] (aa 300-371) (according to UniProt)
[wiki|Cofactors]
NAD+ (according to UniProt)
Structure
[PDB|3DZB] (from ''Streptococcus thermophilus'', 42% identity)
[AF|P20692]
Effectors of protein activity
subject to feedback inhibition by tyrosine [Pubmed|4956345]
Expression and Regulation
Operons
genes
[gene|48C33A96F3B446440D4D9A86AA07AA3BA244063D|trpE]-[gene|4CD2A930753175B7F533EA6B91478577CE80A29C|trpD]-[gene|0467447B10EE7C1FDF86022AB6FBDBABFD32A9E5|trpC]-[gene|C6872585F9BD3717A4F49E96F7684C4A5AD1760D|trpF]-[gene|AEB1F4E28C5B2AFC7FCF65721D4D1A70D6FC38EE|trpB]-[gene|155FE26C148F7022948DD7539533AB6876571862|trpA]-[gene|4D7D62B4CDA350DCDC04E6934B5E23ECE4C57870|hisC]-[gene|DEB8358CE34F80560BE91F036659EF2C67A19623|tyrA]-[gene|CA00DFB480CBDC8AC31559958EF8E97E1E9BD4E1|aroE]
description
[Pubmed|21815947]
regulation
not expressed if tryptophan is available ([protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB]) [Pubmed|1551827]
the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
regulatory mechanism
[protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB]: transcription termination, [pubmed|1551827], in [regulon|protein:E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB regulon]
Open in new tab

[gene|48C33A96F3B446440D4D9A86AA07AA3BA244063D|trpE]→[gene|CA00DFB480CBDC8AC31559958EF8E97E1E9BD4E1|aroE]

2025-10-23 16:06:47

Jstuelk

176

a3b37416002f0f1e65847bd8d15ba18b53400752

AA88BDB7192FA5467301E36C102EEEBB21BEDA86

genes
[gene|4D7D62B4CDA350DCDC04E6934B5E23ECE4C57870|hisC]-[gene|DEB8358CE34F80560BE91F036659EF2C67A19623|tyrA]-[gene|CA00DFB480CBDC8AC31559958EF8E97E1E9BD4E1|aroE]
description
[Pubmed|21815947]
additional information
the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
Open in new tab

[gene|4D7D62B4CDA350DCDC04E6934B5E23ECE4C57870|hisC]→[gene|CA00DFB480CBDC8AC31559958EF8E97E1E9BD4E1|aroE]

2025-10-26 17:40:54

Jstuelk

162

b502e73a1da6c7ae180abdcda54d9a19e58e7035

F5ED1AEC5B7628117F3A30DD1642886538E7A56A

Biological materials
Mutant
GP2358 ∆''[gene|DEB8358CE34F80560BE91F036659EF2C67A19623|tyrA]''::kan, available in [wiki|Jörg Stülke]'s lab
GP4791 ∆''[gene|DEB8358CE34F80560BE91F036659EF2C67A19623|tyrA]''::neo, available in [wiki|Jörg Stülke]'s lab
BKE22610 (Δ[gene|DEB8358CE34F80560BE91F036659EF2C67A19623|tyrA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE22610 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACGTCATCACCTGGTTT,  downstream forward: _UP4_TTTTATGCTGATTGAGGTGG
BKK22610 (Δ[gene|DEB8358CE34F80560BE91F036659EF2C67A19623|tyrA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK22610 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACGTCATCACCTGGTTT,  downstream forward: _UP4_TTTTATGCTGATTGAGGTGG
References
Reviews
12966138
Original Publications
21815947,3106153,4956345,3924737,6436812,1551827,8419914

DEB8358CE34F80560BE91F036659EF2C67A19623

Page visits: 3709

Time of last update: 2025-10-27 17:27:45

Author of last update: Robert.warneke