rplA

168

ribosomal protein uL1

Locus: BSU_01030

Molecular weight: 24.77 kDa

Isoelectric point: 9.73

Protein length: 232 aa

Gene length: 699 bp

Function: translation

Product: ribosomal protein L1 (uL1)

Essential: no

Synonyms: rplA

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0081 (Galperin et al., 2021)

Gene

Coordinates: 119,111  119,809

Phenotypes of a mutant

• slow growth, this can be suppressed by inactivation of mpfA PubMed
• reduced sporulation frequency, this can be suppressed by inactivation of mpfA PubMed

The protein

Protein family

• universal ribosomal protein uL1 family (single member, according to UniProt)

Structure

• 3J9W (PDB) (the ribosome) PubMed
• Q06797 (AlphaFold)

Localization

• ribosome (according to UniProt)
• cytoplasm, region surrounding the nucleoid PubMed

Additional information

• this ribosomal protein is lacking in some organisms with very small genomes PubMed

Expression and Regulation

Operons

• Genes: rplK-rplA-BSU_misc_RNA_3-rplJ-rplL

  Description: PubMed

  Regulation

  • Rel dependent downregulation (Class I) during stringent response PubMed

  Regulatory mechanism

  • stringent response: negative regulation, PubMed, in stringent response

Biological materials

Mutant

• BKE01030 (rplA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTTTAAAATTTCCTCCTT,  downstream forward: _UP4_TAATATTGACATGACATCAA
• BKK01030 (rplA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTTTAAAATTTCCTCCTT,  downstream forward: _UP4_TAATATTGACATGACATCAA

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab

FLAG-tag construct

• GP1094 (erm, based on pGP1087), available in Jörg Stülke's lab

References

Loading