metQ

168

methionine ABC transporter (binding lipoprotein)

Locus: BSU_32730

Molecular weight: 30.20 kDa

Isoelectric point: 8.49

Protein length: 274 aa

Gene length: 825 bp

Function: methionine uptake

Product: methionine ABC transporter (binding lipoprotein)

Essential: no

Synonyms: metQ, yusA

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1464 (Galperin et al., 2021)

Gene

Coordinates: 3,361,767  3,362,591

The protein

Catalyzed reaction/ biological activity

• binding of external methionine

Protein family

• nlpA lipoprotein family (with YhcJ, according to UniProt)

Structure

• 4GOT (PDB)
• O32167 (AlphaFold)

Paralogous protein(s)

• YhcJ

Localization

• associated to the cell membrane, via MetP PubMed
• extracellular (signal peptide) PubMed,  lipid modification as retention signal

Expression and Regulation

Operons

• Genes: metN-metP-metQ

  Description: PubMed

  Regulation

  • activated during growth in the presence of branched chain amino acids (CodY) PubMed
  • the mRNA is processed between metP and metQ by RNase Y, this requires the RicA-RicF-RicT complex PubMed
  • the S-box RNA is degraded by RNase Y PubMed

  Regulatory mechanism

  • S-box: RNA switch, the S-box riboswitch binds S-adenosylmethionine resulting in termination, in S-box
  • CodY: activation, PubMed, in codY regulon

Biological materials

Mutant

• MGNA-A595 (yusA::erm), available at the NBRP B. subtilis, Japan
• BKE32730 (metQ::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_TAGCTTTTTCAATGTAAATC,  downstream forward: _UP4_TAAGACTGAAACCCCGGATG
• BKK32730 (metQ::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_TAGCTTTTTCAATGTAAATC,  downstream forward: _UP4_TAAGACTGAAACCCCGGATG

References

Mahendran A, Orlando BJGenome wide structural prediction of ABC transporter systems in Bacillus subtilis.Frontiers in microbiology. 2024; 15:1469915. PMID: 39397791
O'Reilly FJ, Graziadei A, Forbrig C, Bremenkamp R, Charles K, Lenz S, Elfmann C, Fischer L, Stülke J, Rappsilber JProtein complexes in cells by AI-assisted structural proteomics.Molecular systems biology. 2023 Feb 23; :e11544. PMID: 36815589
DeLoughery A, Lalanne JB, Losick R, Li GW Maturation of polycistronic mRNAs by the endoribonuclease RNase Y and its associated Y-complex in . Proceedings of the National Academy of Sciences of the United States of America. 2018 May 24; . pii:201803283. doi:10.1073/pnas.1803283115. PMID:29794222
Glekas GD, Mulhern BJ, Kroc A, Duelfer KA, Lei V, Rao CV, Ordal GW The Bacillus subtilis chemoreceptor McpC senses multiple ligands using two discrete mechanisms. The Journal of biological chemistry. 2012 Nov 16; 287(47):39412-8. doi:10.1074/jbc.M112.413518. PMID:23038252
Voigt B, Antelmann H, Albrecht D, Ehrenreich A, Maurer KH, Evers S, Gottschalk G, van Dijl JM, Schweder T, Hecker M Cell physiology and protein secretion of Bacillus licheniformis compared to Bacillus subtilis. Journal of molecular microbiology and biotechnology. 2009; 16(1-2):53-68. doi:10.1159/000142894. PMID:18957862
Hahne H, Wolff S, Hecker M, Becher D From complementarity to comprehensiveness--targeting the membrane proteome of growing Bacillus subtilis by divergent approaches. Proteomics. 2008 Oct; 8(19):4123-36. doi:10.1002/pmic.200800258. PMID:18763711
Tomsic J, McDaniel BA, Grundy FJ, Henkin TM Natural variability in S-adenosylmethionine (SAM)-dependent riboswitches: S-box elements in bacillus subtilis exhibit differential sensitivity to SAM In vivo and in vitro. Journal of bacteriology. 2008 Feb; 190(3):823-33. . PMID:18039762
Hullo MF, Auger S, Dassa E, Danchin A, Martin-Verstraete I The metNPQ operon of Bacillus subtilis encodes an ABC permease transporting methionine sulfoxide, D- and L-methionine. Research in microbiology. 2004 Mar; 155(2):80-6. . PMID:14990259
Molle V, Nakaura Y, Shivers RP, Yamaguchi H, Losick R, Fujita Y, Sonenshein AL Additional targets of the Bacillus subtilis global regulator CodY identified by chromatin immunoprecipitation and genome-wide transcript analysis. Journal of bacteriology. 2003 Mar; 185(6):1911-22. . PMID:12618455
Grundy FJ, Henkin TM The S box regulon: a new global transcription termination control system for methionine and cysteine biosynthesis genes in gram-positive bacteria. Molecular microbiology. 1998 Nov; 30(4):737-49. . PMID:10094622
Quentin Y, Fichant G, Denizot F Inventory, assembly and analysis of Bacillus subtilis ABC transport systems. Journal of molecular biology. 1999 Apr 02; 287(3):467-84. . PMID:10092453