nusG

168

transcription termination and pausing factor, stabilizes a sequence-dependent pause at the point of termination, which extends the time frame for RNA hairpins with weak terminal base pairs to form

Locus: BSU_01010

Molecular weight: 19.98 kDa

Isoelectric point: 5.25

Protein length: 177 aa

Gene length: 534 bp

Function: transcription

Product: sequence-specific RNA polymerase termination factor

Essential: no

Synonyms: nusG

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0250 (Galperin et al., 2021)

Gene

Coordinates: 117,890  118,423

Phenotypes of a mutant

• global misregulation of gene expression PubMed
• flagella and swimming motility defects PubMed

The protein

Catalyzed reaction/ biological activity

• binds to the non-template DNA within the paused transcription bubble PubMed
• shifts RNA polymerase to the posttranslocation register and induces pausing at 1,600 sites containing a consensus TTNTTT motif in the nontemplate DNA strand within the paused transcription bubble PubMed
• facilitate transcription termination at 88% of the 1400 identified intrinsic terminators PubMed
• stimulates a sequence-specific pause that assists in the completion of suboptimal terminator hairpins with weak terminal A-U and G-U base pairs at the bottom of the stem PubMed

Domains

• KOW domain (aa 128-156) PubMed

Structure

• 8EHQ (PDB) (the paused transcription complex of Mycobacterium tuberculosis RNA polymerase with B. subtilis NusG) PubMed
• 8EOE (PDB) (the elongation complex of Mycobacterium tuberculosis RNA polymerase with B. subtilis NusG) PubMed
• 2JVV (PDB) (from E. coli, 44% identity) PubMed
• Q06795 (AlphaFold)

Localization

• cytoplasm (according to UniProt)

Biological materials

Mutant

• GP2633 (nusG::cat), available in Jörg Stülke's lab
• BKE01010 (nusG::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTCTATTCAGGACTGTCC,  downstream forward: _UP4_TAATGTGAAAAAACTTGAAA
• BKK01010 (nusG::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTCTATTCAGGACTGTCC,  downstream forward: _UP4_TAATGTGAAAAAACTTGAAA

References

Reviews

Loading

Original Publications

Loading