yvcJ

168

GTPase, nucleotide-binding protein, similar to RNase adaptor protein

Locus: BSU_34770

Molecular weight: 33.70 kDa

Isoelectric point: 6.7

Protein length: 295 aa

Gene length: 888 bp

Function: required for the expression of late competence genes

Product: GTPase

Essential: no

Synonyms: yvcJ

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1660 (Galperin et al., 2021)

Gene

Coordinates: 3,571,501 → 3,572,388

Phenotypes of a mutant

• reduced genetic competence PubMed
• defective in swarming motility (reduced rate of colony expansion) PubMed

The protein

Catalyzed reaction/ biological activity

• binds and hydrolyzes nucleotides, required for the expression of late competence genes (''comK, comS'')  PubMed

Protein family

• RapZ-like family (single member, according to UniProt)

Structure

• 5O5Q (PDB) (RapZ from E. coli, 41% identity) PubMed
• O06973 (AlphaFold)

Localization

• can be localized in the cell either as a helical-like pattern or as foci close to the poles and the septa depending on growth phase and on growth medium PubMed

Additional information

• Information on the E. coli homolog

Expression and Regulation

Operons

• Genes: nahA-yvcJ-glmR-whiA-crh-yvcN

  Description: PubMed

  Regulation

  • constitutive expression at both protein and RNA levels PubMed

  Expression

  • in Enterococcus faecalis: induced upon cell wall stress (vancomycin) (WhiA) PubMed

  Regulatory mechanism

  • WhiA: transcription repression, described for Enterococcus faecalis PubMed, in whiA regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon

  Additional information

  • A ncRNA is predicted between 'yvcI' and 'TrxB' PubMed

Biological materials

Mutant

• MGNA-B641 (yvcJ::erm), available at the NBRP B. subtilis, Japan
• 1A885 ( yvcJ::cat), PubMed, available at BGSC
• BKE34770 (ΔyvcJ::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATCTTTCTCCCCCCTGACT,  downstream forward: _UP4_ATTGAAAAGAGAAGCCGGAA
• BKK34770 (ΔyvcJ::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATCTTTCTCCCCCCTGACT,  downstream forward: _UP4_ATTGAAAAGAGAAGCCGGAA

Expression vectors

• pGP735 (N-terminal Strep-tag, purification from B. subtilis, for SPINE, in pGP380), available in Stülke lab

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Görke lab

Labs working on this gene/protein

• Anne Galinier, University of Marseille, France

References

Reviews

Loading

Original Publications

Loading

Publications on the E. coli homolog

Loading