polA

168

DNA polymerase I, required for repair of UV- or MMS-induced DNA damage, processing of Okazaki fragments

Locus: BSU_29090

Molecular weight: 98.89 kDa

Isoelectric point: 4.92

Protein length: 880 aa

Gene length: 2643 bp

Function: DNA replication

Product: DNA polymerase I

Essential: no

E.C.: 2.7.7.7

Synonyms: polA

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0749 (Galperin et al., 2021)

Gene

Coordinates: 2,973,182  2,975,824

Phenotypes of a mutant

• a polA fenA double mutant is not viable (synthetic lethality) PubMed
• strongly reduced stationary phase mutagenesis PubMed
• reduced survival after DNA replication arrest imposed by inhibition of PolC activity PubMed

The protein

Catalyzed reaction/ biological activity

• has DNA polymerase and 5'-3' exonuclease activity, but no 3'-5' exonuclease activity PubMed
• maturation of Okazaki fragments (together with RNase HIII) PubMed
• 2'-deoxyribonucleoside 5'-triphosphate + DNA_(n) --> diphosphate + DNA_(n+1) (according to UniProt)

Protein family

• DNA polymerase type-A family (single member, according to UniProt)

Domains

• 5'-3' exonuclease domain (aa 174-268) (according to UniProt)
• 3'-5' exonuclease domain (aa 302-470) (according to UniProt)

Structure

• 6VDE (PDB) (from Mycobacterium smegmatis, 40.5% identity) PubMed
• 1XWL (PDB) (large fragment, corresponds to AA 310 to 880, Geobacillus stearothermophilus)
• O34996 (AlphaFold)

Paralogous protein(s)

• FenA, one of the two proteins has to be present for viability PubMed

Localization

• recruited to replication forks after induction of DNA damage PubMed
• recruited to the replication forks PubMed

Expression and Regulation

Operons

• Genes: polA-mutM-ytaF-coaE

  Description: PubMed

  Sigma factors

  • SigE: sigma factor, PubMed, in sigE regulon

Biological materials

Mutant

• GP3532 (ΔpolA::spec), available in Jörg Stülke's lab
• BKE29090 (polA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTCAATTTCCTCCTAAGA,  downstream forward: _UP4_TAAACAGAGATAGGAAGTGA
• BKK29090 (polA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTCAATTTCCTCCTAAGA,  downstream forward: _UP4_TAAACAGAGATAGGAAGTGA

References

Loading