czcD

168

cation exporter (antiporter), export of zinc in exchange for extracellular K⁺ and H⁺

Locus: BSU_26650

Molecular weight: 34.01 kDa

Isoelectric point: 5.86

Protein length: 311 aa

Gene length: 936 bp

Function: cation efflux, resistence against Zn, Cu, Co, Ni

Product: cation exporter (antiporter)

Essential: no

Synonyms: czcD, yrdO

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Cellular processes, Transporters, Transporters/ other, Metal ion transporter

Cellular processes, Homeostasis, Trace metal homeostasis (Cu, Zn, Ni, Mn, Mo), Zinc

Lifestyles, Coping with stress, Resistance against toxic metals

Groups of genes, Membrane proteins

List of homologs in different organisms, belongs to COG1230 (Galperin et al., 2021)

This gene is a member of the following regulons

CzrA regulon

Gene

Coordinates: 2,723,892  2,724,827

The protein

Catalyzed reaction/ biological activity

antiport of cytoplasmic Zn²⁺ in exchange for extracellular K⁺ and H⁺ PubMed

Protein family

Cation diffusion facilitator (CDF) transporter (TC 2.A.4) family (according to UniProt)

Structure

O07084 (AlphaFold)

Localization

cell membrane (according to Swiss-Prot)

Expression and Regulation

Operons

Genes: czcD-czcO

Description: PubMed

Regulation

induced in the presence of toxic metal ions (Zn(II), Cd(II), Co(II), Ni(II) and Cu(II)) (CzrA) PubMed

Regulatory mechanism

CzrA: repression, PubMed, in czrA regulon

Biological materials

Mutant

BKE26650 (czcD::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAAAAAACTCCTCCTTAC,  downstream forward: _UP4_TAAATTTTTTATCTAACTTT
BKK26650 (czcD::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAAAAAACTCCTCCTTAC,  downstream forward: _UP4_TAAATTTTTTATCTAACTTT

References

Moore CM, Gaballa A, Hui M, Ye RW, Helmann JD Genetic and physiological responses of Bacillus subtilis to metal ion stress. Molecular microbiology. 2005 Jul; 57(1):27-40. . PMID:15948947
Guffanti AA, Wei Y, Rood SV, Krulwich TA An antiport mechanism for a member of the cation diffusion facilitator family: divalent cations efflux in exchange for K+ and H+. Molecular microbiology. 2002 Jul; 45(1):145-53. . PMID:12100555