sunT

168

Sublancin 168 lantibiotic ABC transporter

Locus: BSU_21470

Molecular weight: 81.38 kDa

Isoelectric point: 8.39

Protein length: 705 aa

Gene length: 2118 bp

Function: Sublancin export and processing

Product: Sublancin 168 lantibiotic ABC transporter

Essential: no

Synonyms: sunT, yolH

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG2274 (Galperin et al., 2021)

Gene

Coordinates: 2,267,346  2,269,463

The protein

Protein family

• ABC transporter superfamily (according to UniProt)

Domains

• has both a membrane-spanning and an ATP-binding domain PubMed
• Peptidase C39 domain (aa 12-138) (according to UniProt)
• ABC transmembrane type-1 domain (aa 168-450) (according to UniProt)
• ABC transporter domain (aa 483-705) (according to UniProt)

Structure

• 4RY2 (PDB) (from Clostridium thermocellum, 33% identity) PubMed
• P68579 (AlphaFold)

Localization

• membrane PubMed

Expression and Regulation

Operons

• Genes: sunA-sunT-bdbA-sunS-bdbB

  Description: PubMed

  Regulation

  • repressed by Rok-DnaA PubMed
  • expression starts in the stationary phase PubMed
  • expression is heterogeneous in the population, this is mediated by AbrB, Rok, and Spo0A PubMed

  Regulatory mechanism

  • Rok: repression, PubMed, in rok regulon
  • Abh: activation, PubMed, in abh regulon
  • DnaA: repression, Rok-DnaA PubMed, in dnaA regulon
  • YvrHb: activation, PubMed, in yvrHb regulon
  • AbrB: repression, PubMed, in abrB regulon

  Additional information

  • the mRNA is very stable (> 15 min) PubMed
  • the amount of the mRNA is substantially decreased upon depletion of RNase Y PubMed

Biological materials

Mutant

• GP3432 (ΔsunT::spec) , available in Jörg Stülke's lab
• BKE21470 (sunT::erm  trpC2) available in the Bacillus Genetic Stock Center and in Jörg Stülke's lab PubMed
• BKE21470 (sunT::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CAATTTCAATCCCCGCTTTA,  downstream forward: _UP4_TCGGAAAATAAGGAGTATTC
• BKK21470 (sunT::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CAATTTCAATCCCCGCTTTA,  downstream forward: _UP4_TCGGAAAATAAGGAGTATTC

References

Reviews

Gebhard S ABC transporters of antimicrobial peptides in Firmicutes bacteria - phylogeny, function and regulation. Molecular microbiology. 2012 Dec; 86(6):1295-317. doi:10.1111/mmi.12078. PMID:23106164

Original Publications

Mahendran A, Orlando BJGenome wide structural prediction of ABC transporter systems in Bacillus subtilis.Frontiers in microbiology. 2024; 15:1469915. PMID: 39397791
Seid CA, Smith JL, Grossman AD Genetic and biochemical interactions between the bacterial replication initiator DnaA and the nucleoid-associated protein Rok in Bacillus subtilis. Molecular microbiology. 2017 Mar; 103(5):798-817. doi:10.1111/mmi.13590. PMID:27902860
Lin DY, Huang S, Chen J Crystal structures of a polypeptide processing and secretion transporter. Nature. 2015 Jul 23; 523(7561):425-30. doi:10.1038/nature14623. PMID:26201595
Lehnik-Habrink M, Schaffer M, Mäder U, Diethmaier C, Herzberg C, Stülke J RNA processing in Bacillus subtilis: identification of targets of the essential RNase Y. Molecular microbiology. 2011 Sep; 81(6):1459-73. doi:10.1111/j.1365-2958.2011.07777.x. PMID:21815947
Chumsakul O, Takahashi H, Oshima T, Hishimoto T, Kanaya S, Ogasawara N, Ishikawa S Genome-wide binding profiles of the Bacillus subtilis transition state regulator AbrB and its homolog Abh reveals their interactive role in transcriptional regulation. Nucleic acids research. 2011 Jan; 39(2):414-28. doi:10.1093/nar/gkq780. PMID:20817675
Serizawa M, Kodama K, Yamamoto H, Kobayashi K, Ogasawara N, Sekiguchi J Functional analysis of the YvrGHb two-component system of Bacillus subtilis: identification of the regulated genes by DNA microarray and northern blot analyses. Bioscience, biotechnology, and biochemistry. 2005 Nov; 69(11):2155-69. . PMID:16306698
Albano M, Smits WK, Ho LT, Kraigher B, Mandic-Mulec I, Kuipers OP, Dubnau D The Rok protein of Bacillus subtilis represses genes for cell surface and extracellular functions. Journal of bacteriology. 2005 Mar; 187(6):2010-9. . PMID:15743949
Dorenbos R, Stein T, Kabel J, Bruand C, Bolhuis A, Bron S, Quax WJ, Van Dijl JM Thiol-disulfide oxidoreductases are essential for the production of the lantibiotic sublancin 168. The Journal of biological chemistry. 2002 May 10; 277(19):16682-8. . PMID:11872755
Quentin Y, Fichant G, Denizot F Inventory, assembly and analysis of Bacillus subtilis ABC transport systems. Journal of molecular biology. 1999 Apr 02; 287(3):467-84. . PMID:10092453
Ginsburg H, Yeroushalmy S Effects of temperature on the transport of galactose in human erythrocytes. The Journal of physiology. 1978 Sep; 282:399-417. . PMID:722542