comC

168

late competence gene required for processing and translocation of ComGC, ComGD, ComGE and ComGG

Locus: BSU_28070

Molecular weight: 26.37 kDa

Isoelectric point: 9.84

Protein length: 248 aa

Gene length: 747 bp

Function: genetic competence

Product: processing protease

Essential: no

E.C.: null

Synonyms: comC

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Information processing, Genetics, Genetic competence

Information processing, Protein synthesis, modification and degradation, Protein secretion

Lifestyles, Exponential and early post-exponential lifestyles, Genetic competence

Groups of genes, Membrane proteins

List of homologs in different organisms, belongs to COG1989 (Galperin et al., 2021)

This gene is a member of the following regulons

SigA regulon, ComK regulon

Gene

Coordinates: 2,864,426  2,865,172

The protein

Catalyzed reaction/ biological activity

processing and translocation of ComGC, ComGD, ComGE and ComGG PubMed
Typically cleaves a -Gly-|-Phe- bond to release an N-terminal, basic peptide of 5-8 residues from type IV prepilin, and then N-methylates the new N-terminal amino group, the methyl donor being S-adenosyl-L-methionine (according to UniProt)

Protein family

peptidase A24 family (single member, according to UniProt)

Structure

P15378 (AlphaFold)

Localization

integral membrane protein PubMed

Expression and Regulation

Operons

Genes: comC

Description: PubMed

Regulatory mechanism

ComK: activation, PubMed, in comK regulon

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon

Biological materials

Mutant

BKE28070 (comC::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAGACAACACACCTTTAC,  downstream forward: _UP4_TGACTGCTGAAAAATTTGAC
BKK28070 (comC::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAGACAACACACCTTTAC,  downstream forward: _UP4_TGACTGCTGAAAAATTTGAC

References

Reviews

Loading

Original Publications

Loading