rocE

168

amino acid permease

Locus: BSU_40330

Molecular weight: 51.47 kDa

Isoelectric point: 8.53

Protein length: 467 aa

Gene length: 1404 bp

Function: arginine, ornithine and citrulline uptake

Product: amino acid permease

Essential: no

Synonyms: rocE

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0833 (Galperin et al., 2021)

Gene

Coordinates: 4,142,675 → 4,144,078

The protein

Protein family

• amino acid-polyamine-organocation (APC) superfamily (according to UniProt)

Structure

• 6F34 (PDB) (from Geobacillus kaustophilus, 23% identity) PubMed
• P39137 (AlphaFold)

Paralogous protein(s)

• YbgF, YdgF, AapA, GabP, AlaP, HutM, YvbW, AimB, RocC

Localization

• cell membrane (according to UniProt),  membrane associated PubMed

Expression and Regulation

Operons

• Genes: rocD-rocE-rocF

  Description: PubMed

  Regulation

  • induced in the presence of arginine (AhrC) PubMed
  • induced in the presence of arginine, citrulline or ornithine (with ornithine as the molecular inducer) (RocR) PubMed

  Regulatory mechanism

  • Spo0A: repression, PubMed, in spo0A regulon
  • AhrC: activation, PubMed, in ahrC regulon
  • CodY: repression, PubMed, in codY regulon
  • RocR: activation, PubMed, in rocR regulon

  Sigma factors

  • SigL: sigma factor, PubMed, in sigL regulon

  Additional information

  • expression of the rocD-rocE-rocF operon is increased upon depletion of nusA (resulting from increased ahrC expression) Reference

Biological materials

Mutant

• GP1690 ΔrocE::tet, available in Jörg Stülke's lab
• GP4156 (ΔrocC::aphA3, ΔartP-artQ-artR::ermC, ΔrocE::tet,), available in Jörg Stülke's lab
• BKE40330 (ΔrocE::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACATTCTGCACCCCTTCAG,  downstream forward: _UP4_TAAAAACGTTGTCCGCAAGT
• BKK40330 (ΔrocE::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACATTCTGCACCCCTTCAG,  downstream forward: _UP4_TAAAAACGTTGTCCGCAAGT

References

Loading