rocE

168

amino acid permease

Locus: BSU_40330

Molecular weight: 51.47 kDa

Isoelectric point: 8.53

Protein length: 467 aa

Gene length: 1404 bp

Function: arginine, ornithine and citrulline uptake

Product: amino acid permease

Essential: no

Synonyms: rocE

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0833 (Galperin et al., 2021)

Gene

Coordinates: 4,142,675 → 4,144,078

The protein

Protein family

• amino acid-polyamine-organocation (APC) superfamily (according to UniProt)

Structure

• 6F34 (PDB) (from Geobacillus kaustophilus, 23% identity) PubMed
• P39137 (AlphaFold)

Paralogous protein(s)

• YbgF, YdgF, AapA, GabP, AlaP, HutM, YvbW, AimB, RocC

Localization

• cell membrane (according to UniProt),  membrane associated PubMed

Expression and Regulation

Operons

• Genes: rocD-rocE-rocF

  Description: PubMed

  Regulation

  • induced in the presence of arginine (AhrC) PubMed
  • induced in the presence of arginine, citrulline or ornithine (with ornithine as the molecular inducer) (RocR) PubMed

  Regulatory mechanism

  • Spo0A: repression, PubMed, in spo0A regulon
  • AhrC: activation, PubMed, in ahrC regulon
  • CodY: repression, PubMed, in codY regulon
  • RocR: activation, PubMed, in rocR regulon

  Sigma factors

  • SigL: sigma factor, PubMed, in sigL regulon

  Additional information

  • expression of the rocD-rocE-rocF operon is increased upon depletion of nusA (resulting from increased ahrC expression) Reference

Biological materials

Mutant

• GP1690 ΔrocE::tet, available in Jörg Stülke's lab
• GP4156 (ΔrocC::aphA3, ΔartP-artQ-artR::ermC, ΔrocE::tet,), available in Jörg Stülke's lab
• BKE40330 (ΔrocE::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACATTCTGCACCCCTTCAG,  downstream forward: _UP4_TAAAAACGTTGTCCGCAAGT
• BKK40330 (ΔrocE::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACATTCTGCACCCCTTCAG,  downstream forward: _UP4_TAAAAACGTTGTCCGCAAGT

References

Jungnickel KEJ, Parker JL, Newstead S Structural basis for amino acid transport by the CAT family of SLC7 transporters. Nature communications. 2018 Feb 07; 9(1):550. doi:10.1038/s41467-018-03066-6. PMID:29416041
Hahne H, Wolff S, Hecker M, Becher D From complementarity to comprehensiveness--targeting the membrane proteome of growing Bacillus subtilis by divergent approaches. Proteomics. 2008 Oct; 8(19):4123-36. doi:10.1002/pmic.200800258. PMID:18763711
Molle V, Fujita M, Jensen ST, Eichenberger P, González-Pastor JE, Liu JS, Losick R The Spo0A regulon of Bacillus subtilis. Molecular microbiology. 2003 Dec; 50(5):1683-701. . PMID:14651647
Molle V, Nakaura Y, Shivers RP, Yamaguchi H, Losick R, Fujita Y, Sonenshein AL Additional targets of the Bacillus subtilis global regulator CodY identified by chromatin immunoprecipitation and genome-wide transcript analysis. Journal of bacteriology. 2003 Mar; 185(6):1911-22. . PMID:12618455
Gardan R, Rapoport G, Débarbouillé M Expression of the rocDEF operon involved in arginine catabolism in Bacillus subtilis. Journal of molecular biology. 1995 Jun 23; 249(5):843-56. . PMID:7540694