usd

168

putative SpoIIID leader peptide

Locus: BSU_36430

Molecular weight: 4.09 kDa

Isoelectric point: 10.51

Protein length: 36 aa

Gene length: 111 bp

Function: required for translation of SpoIIID

Product: putative SpoIIID leader peptide

Essential: no

Synonyms: usd

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms

Gene

Coordinates: 3,748,717  3,748,827

The protein

Structure

• O32276 (AlphaFold)

Expression and Regulation

Operons

• Genes: usd-spoIIID-mbl

  Description: PubMed

  Regulation

  • expressed early during sporulation in the mother cell (SigE) PubMed.

  Sigma factors

  • SigE: sigma factor, PubMed, in sigE regulon

  Additional information

  • An antisense RNA is predicted for 'mbl' PubMed

Biological materials

Mutant

• BKE36430 (usd::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACGATCCCTCACCTCAAAC,  downstream forward: _UP4_CCATTTTAGGGAGGTCGAGT
• BKK36430 (usd::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACGATCCCTCACCTCAAAC,  downstream forward: _UP4_CCATTTTAGGGAGGTCGAGT

References

Decatur A, McMurry MT, Kunkel BN, Losick R Translation of the mRNA for the sporulation gene spoIIID of Bacillus subtilis is dependent upon translation of a small upstream open reading frame. Journal of bacteriology. 1997 Feb; 179(4):1324-8. . PMID:9023218
Abhayawardhane Y, Stewart GC Bacillus subtilis possesses a second determinant with extensive sequence similarity to the Escherichia coli mreB morphogene. Journal of bacteriology. 1995 Feb; 177(3):765-73. . PMID:7836311