crh

168

Carbon-flux regulating HPr, formerly known as Catabolite repression HPr-like protein, control of flux through the harmful methylglyoxal pathway, minor cofactor of the CcpA transcription factor

Locus: BSU_34740

Molecular weight: 9.19 kDa

Isoelectric point: 4.7

Protein length: 85 aa

Gene length: 258 bp

Function: control of carbon flux

Product: carbon-flux regulating HPr

Essential: no

Synonyms: crh, yvcM

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1925 (Galperin et al., 2021)

Gene

Coordinates: 3,569,292  3,569,549

The protein

Protein family

• HPr family (with PtsH, according to UniProt)

Domains

• Hpr domain (aa 1-85) (according to UniProt)

Structure

• 2AK7 (PDB) (dimeric Crh-Ser46-P) PubMed
• 1ZVV (PDB) (CcpA-Crh-DNA complex)
• 2RLZ (PDB) (dimer)
• 1MU4 (PDB)
• O06976 (AlphaFold)

Modification

• phosphorylation on Ser46 by HprK PubMed

Paralogous protein(s)

• PtsH

Additional information

• Crh does not possess the phosphorylation site used for PtsI phosphotransfer (His-15 in PtsH), it can only be phosphorylated on Ser-46

Expression and Regulation

Operons

• Genes: nahA-yvcJ-glmR-whiA-crh-yvcN

  Description: PubMed

  Regulation

  • constitutive expression at both protein and RNA levels PubMed

  Expression

  • in Enterococcus faecalis: induced upon cell wall stress (vancomycin) (WhiA) PubMed

  Regulatory mechanism

  • WhiA: transcription repression, described for Enterococcus faecalis PubMed, in whiA regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon

  Additional information

  • A ncRNA is predicted between 'yvcI' and 'TrxB' PubMed

Biological materials

Mutant

• GP860 (Δcrh::aphA3) PubMed, available in Jörg Stülke's lab
• QB7097 (spc), available in Jörg Stülke's lab
• BKE34740 (Δcrh::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAAGATCTCCCCTTTTCT,  downstream forward: _UP4_GCTTACGTTCAAGAAGAAGT
• BKK34740 (Δcrh::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAAGATCTCCCCTTTTCT,  downstream forward: _UP4_GCTTACGTTCAAGAAGAAGT

Expression vectors

• pGP641 (N-terminal Strep-tag, purification from B. subtilis, for SPINE, in pGP380), available in Jörg Stülke's lab
• pGP734 (C-terminal Strep-tag, purification from B. subtilis, for SPINE, in pGP382), available in Jörg Stülke's lab
• pGP3110 (N-terminal Strep-tag, purification from E. coli,in pGP172), available in Jörg Stülke's lab

Two-hybrid system

• crh, crh(Ser46Asp), crh(Ser46Ala) B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab

LacZ fusion

• see nahA

Labs working on this gene/protein

• Anne Galinier, University of Marseille, France
• Richard Brennan, Houston, Texas, USA Homepage

References

O'Reilly FJ, Graziadei A, Forbrig C, Bremenkamp R, Charles K, Lenz S, Elfmann C, Fischer L, Stülke J, Rappsilber JProtein complexes in cells by AI-assisted structural proteomics.Molecular systems biology. 2023 Feb 23; :e11544. PMID: 36815589
Dickmanns A, Zschiedrich CP, Arens J, Parfentev I, Gundlach J, Hofele R, Neumann P, Urlaub H, Görke B, Ficner R, Stulke J Structural basis for the regulatory interaction of the methylglyoxal synthase MgsA with the carbon flux regulator Crh in. The Journal of biological chemistry. 2018 Mar 07; . pii:jbc.RA117.001289. doi:10.1074/jbc.RA117.001289. PMID:29514981
Landmann JJ, Werner S, Hillen W, Stülke J, Görke B Carbon source control of the phosphorylation state of the Bacillus subtilis carbon-flux regulator Crh in vivo. FEMS microbiology letters. 2012 Feb; 327(1):47-53. doi:10.1111/j.1574-6968.2011.02456.x. PMID:22092971
Landmann JJ, Busse RA, Latz JH, Singh KD, Stülke J, Görke B Crh, the paralogue of the phosphocarrier protein HPr, controls the methylglyoxal bypass of glycolysis in Bacillus subtilis. Molecular microbiology. 2011 Nov; 82(3):770-87. doi:10.1111/j.1365-2958.2011.07857.x. PMID:21992469
Gardiennet C, Loquet A, Etzkorn M, Heise H, Baldus M, Böckmann A Structural constraints for the Crh protein from solid-state NMR experiments. Journal of biomolecular NMR. 2008 Apr; 40(4):239-50. doi:10.1007/s10858-008-9229-3. PMID:18320329
Loquet A, Bardiaux B, Gardiennet C, Blanchet C, Baldus M, Nilges M, Malliavin T, Böckmann A 3D structure determination of the Crh protein from highly ambiguous solid-state NMR restraints. Journal of the American Chemical Society. 2008 Mar 19; 130(11):3579-89. doi:10.1021/ja078014t. PMID:18284240
Pompeo F, Luciano J, Galinier A Interaction of GapA with HPr and its homologue, Crh: Novel levels of regulation of a key step of glycolysis in Bacillus subtilis? Journal of bacteriology. 2007 Feb; 189(3):1154-7. . PMID:17142398
Chaptal V, Larivière L, Gueguen-Chaignon V, Galinier A, Nessler S, Moréra S X-ray structure of a domain-swapped dimer of Ser46-phosphorylated Crh from Bacillus subtilis. Proteins. 2006 Apr 01; 63(1):249-51. . PMID:16411239
Schumacher MA, Seidel G, Hillen W, Brennan RG Phosphoprotein Crh-Ser46-P displays altered binding to CcpA to effect carbon catabolite regulation. The Journal of biological chemistry. 2006 Mar 10; 281(10):6793-800. . PMID:16316990
Görke B, Foulquier E, Galinier A YvcK of Bacillus subtilis is required for a normal cell shape and for growth on Krebs cycle intermediates and substrates of the pentose phosphate pathway. Microbiology (Reading, England). 2005 Nov; 151(Pt 11):3777-91. . PMID:16272399
Görke B, Fraysse L, Galinier A Drastic differences in Crh and HPr synthesis levels reflect their different impacts on catabolite repression in Bacillus subtilis. Journal of bacteriology. 2004 May; 186(10):2992-5. . PMID:15126459
Juy M, Penin F, Favier A, Galinier A, Montserret R, Haser R, Deutscher J, Böckmann A Dimerization of Crh by reversible 3D domain swapping induces structural adjustments to its monomeric homologue Hpr. Journal of molecular biology. 2003 Sep 26; 332(4):767-76. . PMID:12972249
Warner JB, Lolkema JS A Crh-specific function in carbon catabolite repression in Bacillus subtilis. FEMS microbiology letters. 2003 Mar 28; 220(2):277-80. . PMID:12670692
Lavergne JP, Jault JM, Galinier A Insights into the functioning of Bacillus subtilis HPr kinase/phosphatase: affinity for its protein substrates and role of cations and phosphate. Biochemistry. 2002 May 21; 41(20):6218-25. . PMID:12009882
Favier A, Brutscher B, Blackledge M, Galinier A, Deutscher J, Penin F, Marion D Solution structure and dynamics of Crh, the Bacillus subtilis catabolite repression HPr. Journal of molecular biology. 2002 Mar 15; 317(1):131-44. . PMID:11916384
Darbon E, Galinier A, Le Coq D, Deutscher J Phosphotransfer functions mutated Bacillus subtilis HPr-like protein Crh carrying a histidine in the active site. Journal of molecular microbiology and biotechnology. 2001 Jul; 3(3):439-44. . PMID:11361076
Penin F, Favier A, Montserret R, Brutscher B, Deutscher J, Marion D, Galinier D Evidence for a dimerisation state of the Bacillus subtilis catabolite repression HPr-like protein, Crh. Journal of molecular microbiology and biotechnology. 2001 Jul; 3(3):429-32. . PMID:11361074
Martin-Verstraete I, Galinier A, Darbon E, Quentin Y, Kilhoffer MC, Charrier V, Haiech J, Rapoport G, Deutscher J The Q15H mutation enables Crh, a Bacillus subtilis HPr-like protein, to carry out some regulatory HPr functions, but does not make it an effective phosphocarrier for sugar transport. Microbiology (Reading, England). 1999 Nov; 145 ( Pt 11):3195-204. . PMID:10589728
Martin-Verstraete I, Deutscher J, Galinier A Phosphorylation of HPr and Crh by HprK, early steps in the catabolite repression signalling pathway for the Bacillus subtilis levanase operon. Journal of bacteriology. 1999 May; 181(9):2966-9. . PMID:10217795
Galinier A, Deutscher J, Martin-Verstraete I Phosphorylation of either crh or HPr mediates binding of CcpA to the bacillus subtilis xyn cre and catabolite repression of the xyn operon. Journal of molecular biology. 1999 Feb 19; 286(2):307-14. . PMID:9973552
Galinier A, Haiech J, Kilhoffer MC, Jaquinod M, Stülke J, Deutscher J, Martin-Verstraete I The Bacillus subtilis crh gene encodes a HPr-like protein involved in carbon catabolite repression. Proceedings of the National Academy of Sciences of the United States of America. 1997 Aug 05; 94(16):8439-44. . PMID:9237995