crh

168

Carbon-flux regulating HPr, formerly known as Catabolite repression HPr-like protein, control of flux through the harmful methylglyoxal pathway, minor cofactor of the CcpA transcription factor

Locus: BSU_34740

Molecular weight: 9.19 kDa

Isoelectric point: 4.7

Protein length: 85 aa

Gene length: 258 bp

Function: control of carbon flux

Product: carbon-flux regulating HPr

Essential: no

Synonyms: crh, yvcM

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1925 (Galperin et al., 2021)

Gene

Coordinates: 3,569,292  3,569,549

The protein

Protein family

• HPr family (with PtsH, according to UniProt)

Domains

• Hpr domain (aa 1-85) (according to UniProt)

Structure

• 2AK7 (PDB) (dimeric Crh-Ser46-P) PubMed
• 1ZVV (PDB) (CcpA-Crh-DNA complex)
• 2RLZ (PDB) (dimer)
• 1MU4 (PDB)
• O06976 (AlphaFold)

Modification

• phosphorylation on Ser46 by HprK PubMed

Paralogous protein(s)

• PtsH

Additional information

• Crh does not possess the phosphorylation site used for PtsI phosphotransfer (His-15 in PtsH), it can only be phosphorylated on Ser-46

Expression and Regulation

Operons

• Genes: nahA-yvcJ-glmR-whiA-crh-yvcN

  Description: PubMed

  Regulation

  • constitutive expression at both protein and RNA levels PubMed

  Expression

  • in Enterococcus faecalis: induced upon cell wall stress (vancomycin) (WhiA) PubMed

  Regulatory mechanism

  • WhiA: transcription repression, described for Enterococcus faecalis PubMed, in whiA regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon

  Additional information

  • A ncRNA is predicted between 'yvcI' and 'TrxB' PubMed

Biological materials

Mutant

• GP860 (Δcrh::aphA3) PubMed, available in Jörg Stülke's lab
• QB7097 (spc), available in Jörg Stülke's lab
• BKE34740 (Δcrh::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAAGATCTCCCCTTTTCT,  downstream forward: _UP4_GCTTACGTTCAAGAAGAAGT
• BKK34740 (Δcrh::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAAGATCTCCCCTTTTCT,  downstream forward: _UP4_GCTTACGTTCAAGAAGAAGT

Expression vectors

• pGP641 (N-terminal Strep-tag, purification from B. subtilis, for SPINE, in pGP380), available in Jörg Stülke's lab
• pGP734 (C-terminal Strep-tag, purification from B. subtilis, for SPINE, in pGP382), available in Jörg Stülke's lab
• pGP3110 (N-terminal Strep-tag, purification from E. coli,in pGP172), available in Jörg Stülke's lab

Two-hybrid system

• crh, crh(Ser46Asp), crh(Ser46Ala) B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab

LacZ fusion

• see nahA

Labs working on this gene/protein

• Anne Galinier, University of Marseille, France
• Richard Brennan, Houston, Texas, USA Homepage

References

Loading