ganP

168

galactotriose ABC transporter (permease)

Locus: BSU_34150

Molecular weight: 46.82 kDa

Isoelectric point: 6.09

Protein length: 418 aa

Gene length: 1257 bp

Function: uptake of galactotriose

Product: galactotriose ABC transporter (permease)

Essential: no

Synonyms: ganP, yvfL

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Cellular processes, Transporters, ABC transporters, Importers, Uptake of carbon sources

Metabolism, Carbon metabolism, Utilization of specific carbon sources, Utilization of galactan

Groups of genes, Membrane proteins

List of homologs in different organisms, belongs to COG1175 (Galperin et al., 2021)

This gene is a member of the following regulons

SigA regulon, CcpA regulon, GanR regulon

Gene

Coordinates: 3,505,957  3,507,213

Phenotypes of a mutant

a ''ganS-ganP-ganQ-ganA-ganB'' mutant is impaired in the utilization of galactan PubMed

The protein

Protein family

Binding-protein-dependent transport system permease family (according to UniProt)

Domains

ABC transmembrane type-1 domain (aa 187-407) (according to UniProt)

Structure

2R6G (PDB) (from E. coli, C-terminal domain, aa 165-412, 41% identity) PubMed
O32261 (AlphaFold)

Paralogous protein(s)

MdxF

Localization

cell membrane PubMed

Expression and Regulation

Operons

Genes: ganS-ganP-ganQ-ganA-ganB

Description: PubMed

Regulation

induced by galactan (binding of galactobiose to GanR) PubMed
repressed by glucose (CcpA) PubMed

Regulatory mechanism

GanR: repression, PubMed, in ganR regulon
CcpA: repression, PubMed, in ccpA regulon

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon

Biological materials

Mutant

MGNA-A485 (yvfL::erm), available at the NBRP B. subtilis, Japan
BKE34150 (ganP::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACCGTTTTCACCTCTCTTA,  downstream forward: _UP4_TCTTTTAAAGAGGAGGCATA
BKK34150 (ganP::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACCGTTTTCACCTCTCTTA,  downstream forward: _UP4_TCTTTTAAAGAGGAGGCATA

References

Mahendran A, Orlando BJGenome wide structural prediction of ABC transporter systems in Bacillus subtilis.Frontiers in microbiology. 2024; 15:1469915. PMID: 39397791
Watzlawick H, Morabbi Heravi K, Altenbuchner J Role of the ganSPQAB Operon in Degradation of Galactan by Bacillus subtilis. Journal of bacteriology. 2016 Oct 15; 198(20):2887-96. doi:10.1128/JB.00468-16. PMID:27501980
Chai Y, Beauregard PB, Vlamakis H, Losick R, Kolter R Galactose metabolism plays a crucial role in biofilm formation by Bacillus subtilis. mBio. 2012; 3(4):e00184-12. doi:10.1128/mBio.00184-12. pii:e00184-12. PMID:22893383
Oldham ML, Khare D, Quiocho FA, Davidson AL, Chen J Crystal structure of a catalytic intermediate of the maltose transporter. Nature. 2007 Nov 22; 450(7169):515-21. . PMID:18033289
Quentin Y, Fichant G, Denizot F Inventory, assembly and analysis of Bacillus subtilis ABC transport systems. Journal of molecular biology. 1999 Apr 02; 287(3):467-84. . PMID:10092453
Daniel RA, Haiech J, Denizot F, Errington J Isolation and characterization of the lacA gene encoding beta-galactosidase in Bacillus subtilis and a regulator gene, lacR. Journal of bacteriology. 1997 Sep; 179(17):5636-8. . PMID:9287030