yvbX

168

putative glycoside hydrolase

Locus: BSU_34020

Molecular weight: 38.79 kDa

Isoelectric point: 9.93

Protein length: 344 aa

Gene length: 1035 bp

Function: unknown

Product: unknown

Essential: no

Synonyms: yvbX

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Cellular processes, Cell envelope and cell division, Cell wall/ other

Groups of genes, Proteins of unknown function

List of homologs in different organisms, belongs to COG3858 (Galperin et al., 2021)

Gene

Coordinates: 3,491,655 → 3,492,689

The protein

Protein family

Glycosyl hydrolase 18 family (according to UniProt)

Domains

glycoside hydrolase family 18 domain (aa 25 to 344)

Structure

5JH8 (PDB) (from Chromobacterium violaceum, 34% identity)
O32258 (AlphaFold)

Biological materials

Mutant

MGNA-A469 (yvbX::erm), available at the NBRP B. subtilis, Japan
BKE34020 (ΔyvbX::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATCGCATTTCCTCCTGTAT,  downstream forward: _UP4_TAACAGTTTCTTTTTTCTCT
BKK34020 (ΔyvbX::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATCGCATTTCCTCCTGTAT,  downstream forward: _UP4_TAACAGTTTCTTTTTTCTCT