yvgK

168

similar to molybdenum-binding protein

Locus: BSU_33370

Molecular weight: 34.01 kDa

Isoelectric point: 6.36

Protein length: 308 aa

Gene length: 927 bp

Function: unknown

Product: unknown

Essential: no

E.C.: null

Synonyms: yvgK, yvsE

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Cellular processes, Transporters, Transporters/ other, Other transporters

List of homologs in different organisms, belongs to COG1910 (Galperin et al., 2021)

Gene

Coordinates: 3,424,235  3,425,161

The protein

Structure

O32207 (AlphaFold)

Expression and Regulation

Operons

Genes: yvgK

Description: PubMed

Biological materials

Mutant

MGNA-B064 (yvgK::erm), available at the NBRP B. subtilis, Japan
1A994 ( yvgK::spec), PubMed, available at BGSC
1A994 ( yvgK::spec), PubMed, available at BGSC
BKE33370 (yvgK::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATCATCATCACTCTCCTAT,  downstream forward: _UP4_TAAAAAATCCCTCTTGATAG
BKK33370 (yvgK::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATCATCATCACTCTCCTAT,  downstream forward: _UP4_TAAAAAATCCCTCTTGATAG