cssS

168

two-component sensor kinase, control of cellular responses to protein secretion stress

Locus: BSU_33020

Molecular weight: 51.92 kDa

Isoelectric point: 5.8

Protein length: 451 aa

Gene length: 1356 bp

Function: control of cellular responses to protein secretion stress

Product: two-component sensor kinase

Essential: no

Synonyms: cssS, yvqB

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Information processing, Protein synthesis, modification and degradation, Protein modification, Protein kinases

Information processing, Regulation of gene expression, Transcription factors and their control, Control of two-component response regulators, Two-component sensor kinase

Lifestyles, Coping with stress, Heat shock proteins

Groups of genes, Membrane proteins

Groups of genes, Phosphoproteins, Phosphorylation on a His residue

List of homologs in different organisms, belongs to COG0642 (Galperin et al., 2021)

This gene is a member of the following regulons

SigA regulon, CssR regulon

Gene

Coordinates: 3,386,398  3,387,753

The protein

Catalyzed reaction/ biological activity

autophosphorylation, phosphorylation of CssR
ATP + protein L-histidine --> ADP + protein N-phospho-L-histidine (according to UniProt)

Domains

two transmembrane segments, C-terminal histidine phosphotransferase domain
HAMP domain (aa 287-239) (according to UniProt)
Histidine kinase domain (aa 247-451) (according to UniProt)

Structure

O32193 (AlphaFold)

Modification

autophosphorylation on a His residue

Effectors of protein activity

the extracellular loop domain is required for signal perception PubMed

Paralogous protein(s)

YclK, YvrG, YkoH, KinE

Localization

cell membrane (according to Swiss-Prot)
localized primarily at the division septum but also found in a punctate pattern with lower intensity throughout the cell cylinder  PubMed

Expression and Regulation

Operons

Genes: cssR-cssS

Description: PubMed

Regulation

expressed under conditions of secretion stress (CssR) PubMed

Regulatory mechanism

CssR: activation, PubMed, in cssR regulon

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon

Biological materials

Mutant

MGNA-B216 (yvqB::erm), available at the NBRP B. subtilis, Japan
BKE33020 (cssS::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_TTTCATGATGACATCATCCT,  downstream forward: _UP4_TAGACTGTAGATGTTTTGCA
BKK33020 (cssS::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_TTTCATGATGACATCATCCT,  downstream forward: _UP4_TAGACTGTAGATGTTTTGCA

References

Reviews

Schumann W Regulation of bacterial heat shock stimulons. Cell stress & chaperones. 2016 Nov; 21(6):959-968. . PMID:27518094

Original Publications

Kachan AV, Evtushenkov ANThe CssRS two-component system of Bacillus subtilis contributes to teicoplanin and polymyxin B response.Folia microbiologica. 2024 Jun 7; . PMID: 38847924
Noone D, Botella E, Butler C, Hansen A, Jende I, Devine KM Signal perception by the secretion stress-responsive CssRS two-component system in Bacillus subtilis. Journal of bacteriology. 2012 Apr; 194(7):1800-14. doi:10.1128/JB.05767-11. PMID:22307758
Marchadier E, Carballido-López R, Brinster S, Fabret C, Mervelet P, Bessières P, Noirot-Gros MF, Fromion V, Noirot P An expanded protein-protein interaction network in Bacillus subtilis reveals a group of hubs: Exploration by an integrative approach. Proteomics. 2011 Aug; 11(15):2981-91. doi:10.1002/pmic.201000791. PMID:21630458
Trip H, van der Veek PJ, Renniers TC, Meima R, Sagt CM, Mohrmann L, Kuipers OP A novel screening system for secretion of heterologous proteins in Bacillus subtilis. Microbial biotechnology. 2011 Sep; 4(5):673-82. doi:10.1111/j.1751-7915.2011.00270.x. PMID:21624103
Kashyap DR, Wang M, Liu LH, Boons GJ, Gupta D, Dziarski R Peptidoglycan recognition proteins kill bacteria by activating protein-sensing two-component systems. Nature medicine. 2011 Jun; 17(6):676-83. doi:10.1038/nm.2357. PMID:21602801
Zweers JC, Wiegert T, van Dijl JM Stress-responsive systems set specific limits to the overproduction of membrane proteins in Bacillus subtilis. Applied and environmental microbiology. 2009 Dec; 75(23):7356-64. doi:10.1128/AEM.01560-09. PMID:19820159
Hyyryläinen HL, Pietiäinen M, Lundén T, Ekman A, Gardemeister M, Murtomäki-Repo S, Antelmann H, Hecker M, Valmu L, Sarvas M, Kontinen VP The density of negative charge in the cell wall influences two-component signal transduction in Bacillus subtilis. Microbiology (Reading, England). 2007 Jul; 153(Pt 7):2126-36. . PMID:17600057
Darmon E, Dorenbos R, Meens J, Freudl R, Antelmann H, Hecker M, Kuipers OP, Bron S, Quax WJ, Dubois JY, van Dijl JM A disulfide bond-containing alkaline phosphatase triggers a BdbC-dependent secretion stress response in Bacillus subtilis. Applied and environmental microbiology. 2006 Nov; 72(11):6876-85. . PMID:17088376
Darmon E, Noone D, Masson A, Bron S, Kuipers OP, Devine KM, van Dijl JM A novel class of heat and secretion stress-responsive genes is controlled by the autoregulated CssRS two-component system of Bacillus subtilis. Journal of bacteriology. 2002 Oct; 184(20):5661-71. . PMID:12270824
Hyyryläinen HL, Bolhuis A, Darmon E, Muukkonen L, Koski P, Vitikainen M, Sarvas M, Prágai Z, Bron S, van Dijl JM, Kontinen VP A novel two-component regulatory system in Bacillus subtilis for the survival of severe secretion stress. Molecular microbiology. 2001 Sep; 41(5):1159-72. . PMID:11555295
Fabret C, Feher VA, Hoch JA Two-component signal transduction in Bacillus subtilis: how one organism sees its world. Journal of bacteriology. 1999 Apr; 181(7):1975-83. . PMID:10094672