yusN

168

unknown

Locus: BSU_32860

Molecular weight: 13.00 kDa

Isoelectric point: 4.49

Protein length: 110 aa

Gene length: 333 bp

Function: unknown

Product: unknown

Essential: no

Synonyms: yusN

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms

Gene

Coordinates: 3,374,001  3,374,333

The protein

Structure

• O32180 (AlphaFold)

Expression and Regulation

Operons

• Genes: yuzM-yusN

  Description: PubMed

  Sigma factors

  • SigG: sigma factor, PubMed, in sigG regulon

Additional information

• the mRNA belongs to the 46 most abundant mRNA species in dormant spores PubMed

Biological materials

Mutant

• MGNA-B594 (yusN::erm), available at the NBRP B. subtilis, Japan
• BKE32860 (yusN::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_TTGCTGATTCATTCTGGCGC,  downstream forward: _UP4_TAACAACATTAGTAAAAAGG
• BKK32860 (yusN::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_TTGCTGATTCATTCTGGCGC,  downstream forward: _UP4_TAACAACATTAGTAAAAAGG

References

Korza G, Camilleri E, Green J, Robinson J, Nagler K, Moeller R, Caimano MJ, Setlow P Analysis of the Messenger RNAs in Spores of . Journal of bacteriology. 2019 Feb 19; . pii:JB.00007-19. doi:10.1128/JB.00007-19. PMID:30782632
Wang ST, Setlow B, Conlon EM, Lyon JL, Imamura D, Sato T, Setlow P, Losick R, Eichenberger P The forespore line of gene expression in Bacillus subtilis. Journal of molecular biology. 2006 Apr 21; 358(1):16-37. . PMID:16497325