yunD

168

putative metallophosphoesterase

Locus: BSU_32370

Molecular weight: 51.71 kDa

Isoelectric point: 4.81

Protein length: 462 aa

Gene length: 1389 bp

Function: unknown

Product: unknown

Essential: no

Synonyms: yunD

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Groups of genes, Proteins of unknown function

List of homologs in different organisms, belongs to COG0737 (Galperin et al., 2021)

Gene

Coordinates: 3,323,670  3,325,058

The protein

Protein family

Metallophosphoesterase superfamily (according to UniProt)

Structure

2Z1A (PDB) (from Thermus thermophilus, aa 5 ... 366, 24% identity)
O32133 (AlphaFold)

Expression and Regulation

Operons

Genes: yunG-yunF-yunE-yunD-yunC

Description: PubMed

Genes: yunF-yunE-yunD-yunC

Description: PubMed

Biological materials

Mutant

MGNA-A980 (yunD::erm), available at the NBRP B. subtilis, Japan
BKE32370 (yunD::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CTTCATAATATCTCTCCCTA,  downstream forward: _UP4_TAAGGCAGTCAGCCCACAAC
BKK32370 (yunD::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CTTCATAATATCTCTCCCTA,  downstream forward: _UP4_TAAGGCAGTCAGCCCACAAC