yuiE

168

similar to leucyl aminopeptidase

Locus: BSU_32050

Molecular weight: 53.49 kDa

Isoelectric point: 4.55

Protein length: 500 aa

Gene length: 1503 bp

Function: unknown

Product: unknown

Essential: no

Synonyms: yuiE

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0260 (Galperin et al., 2021)

Gene

Coordinates: 3,296,417 → 3,297,919

The protein

Catalyzed reaction/ biological activity

• Release of an N-terminal amino acid, Xaa-|-Yaa-, in which Xaa is preferably Leu, but may be other amino acids including Pro although not Arg or Lys, and Yaa may be Pro. Amino acid amides and methyl esters are also readily hydrolyzed, but rates on arylamides are exceedingly low (according to UniProt)
• Release of an N-terminal amino acid, preferentially leucine, but not glutamic or aspartic acids (according to UniProt)

Protein family

• peptidase M17 family (single member, according to UniProt)

Structure

• 3H8E (PDB) (from Pseudomonas putida 37% identity) PubMed
• O32106 (AlphaFold)

Expression and Regulation

Operons

• Genes: yuiE

  Description: PubMed

Biological materials

Mutant

• MGNA-B569 (yuiE::erm), available at the NBRP B. subtilis, Japan
• BKE32050 (ΔyuiE::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGAGGCTTACACTCCTAA,  downstream forward: _UP4_TAATGAAAAATCCCTGCTGT
• BKK32050 (ΔyuiE::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGAGGCTTACACTCCTAA,  downstream forward: _UP4_TAATGAAAAATCCCTGCTGT

References

Research papers

Loading