adeR

168

transcription activator (PucR family) for ald gene expression

Locus: BSU_31920

Molecular weight: 50.14 kDa

Isoelectric point: 8.15

Protein length: 422 aa

Gene length: 1269 bp

Function: control of ald expression

Product: transcription activator (PucR family)

Essential: no

Synonyms: adeR, yukF

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG2508 (Galperin et al., 2021)

Gene

Coordinates: 3,276,955  3,278,223

Phenotypes of a mutant

• sporulation defect due to lack of ''ald'' expression PubMed

The protein

Catalyzed reaction/ biological activity

• transcription activation of ''ald'' gene expression in the presence of alanine PubMed

Protein family

• PucR family
• CdaR family (according to UniProt)

Structure

• P71073 (AlphaFold)

Modification

• phosphorylated on Ser-395 PubMed

Effectors of protein activity

• L-alanine PubMed

Expression and Regulation

Operons

• Genes: adeR

  Description: PubMed

  Regulation

  • constitutively expressed PubMed

Biological materials

Mutant

• MGNA-A631 (yukF::erm), available at the NBRP B. subtilis, Japan
• BKE31920 (adeR::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATCTCATCCCCTTCCTTTT,  downstream forward: _UP4_TGAAATTTCACAAATCCATG
• BKK31920 (adeR::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATCTCATCCCCTTCCTTTT,  downstream forward: _UP4_TGAAATTTCACAAATCCATG

References

Lin TH, Wei GT, Su CC, Shaw GC AdeR, a PucR-type transcription factor, activates expression of L-alanine dehydrogenase and is required for sporulation of Bacillus subtilis. Journal of bacteriology. 2012 Sep; 194(18):4995-5001. doi:10.1128/JB.00778-12. PMID:22797752
Soufi B, Kumar C, Gnad F, Mann M, Mijakovic I, Macek B Stable isotope labeling by amino acids in cell culture (SILAC) applied to quantitative proteomics of Bacillus subtilis. Journal of proteome research. 2010 Jul 02; 9(7):3638-46. doi:10.1021/pr100150w. PMID:20509597
Siranosian KJ, Ireton K, Grossman AD Alanine dehydrogenase (ald) is required for normal sporulation in Bacillus subtilis. Journal of bacteriology. 1993 Nov; 175(21):6789-96. . PMID:8226620