yueD

168

similar to sepiapterin reductase

Locus: BSU_31840

Molecular weight: 26.96 kDa

Isoelectric point: 6.43

Protein length: 243 aa

Gene length: 732 bp

Function: unknown

Product: unknown

Essential: no

Synonyms: yueD

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1028 (Galperin et al., 2021)

Gene

Coordinates: 3,265,406 → 3,266,137

The protein

Catalyzed reaction/ biological activity

• (S)-benzoin + NADP⁺ --> benzil + H⁺ + NADPH (according to UniProt)

Protein family

• Short-chain dehydrogenases/reductases (SDR) family (according to UniProt)

Structure

• 5IF3 (PDB) (from Burkholderia Vietnamiensis 34% identity)
• O32099 (AlphaFold)

Expression and Regulation

Operons

• Genes: yueD

  Description: PubMed

• Genes: yukE-yukD-essB-yukB-yueB-yueC-yueD

  Description: PubMed

  Regulation

  • expressed in the stationary phase PubMed
  • expression is reduced in motile cells as compared to non-motile cells PubMed

  Regulatory mechanism

  • DegU: activation, DegU-P, PubMed, in degU regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon

Biological materials

Mutant

• MGNA-B564 (yueD::erm), available at the NBRP B. subtilis, Japan
• BKE31840 (ΔyueD::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTGGAAACCTCCTTTTCC,  downstream forward: _UP4_TAGAGCAGATATTTTCTGCT
• BKK31840 (ΔyueD::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTGGAAACCTCCTTTTCC,  downstream forward: _UP4_TAGAGCAGATATTTTCTGCT