mntC

168

manganese ABC transporter (membrane protein)

Locus: BSU_30750

Molecular weight: 47.78 kDa

Isoelectric point: 9.35

Protein length: 435 aa

Gene length: 1308 bp

Function: manganese uptake

Product: manganese ABC transporter (membrane protein)

Essential: no

Synonyms: mntC, ytgC

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1321 (Galperin et al., 2021)

Gene

Coordinates: 3,142,954  3,144,261

The protein

Protein family

• ABC-3 integral membrane protein family (with ZnuB and MntD, according to UniProt)

Structure

• O35024 (AlphaFold)

Localization

• cell membrane (according to UniProt)

Expression and Regulation

Operons

• Genes: mntA-mntB-mntC-mntD

  Description: PubMed

  Regulation

  • repressed at high Mn(II) concentrations (MntR) PubMed

  Regulatory mechanism

  • MntR: repression, PubMed, in mntR regulon

  Additional information

  • A ncRNA is predicted between 'mntA' and 'menC' PubMed

Biological materials

Mutant

• MGNA-A287 (ytgC::erm), available at the NBRP B. subtilis, Japan
• BKE30750 (mntC::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CCACAAACTTTCAAACATTG,  downstream forward: _UP4_GATGCCGAGAAGGGACAGAT
• BKK30750 (mntC::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CCACAAACTTTCAAACATTG,  downstream forward: _UP4_GATGCCGAGAAGGGACAGAT

Labs working on this gene/protein

• John Helmann, Cornell University, USA Homepage

References

Reviews

Bosma EF, Rau MH, van Gijtenbeek LA, Siedler SRegulation and distinct physiological roles of manganese in bacteria.FEMS microbiology reviews. 2021 Nov 23; 45(6). PMID: 34037759

Original Publications

Mahendran A, Orlando BJGenome wide structural prediction of ABC transporter systems in Bacillus subtilis.Frontiers in microbiology. 2024; 15:1469915. PMID: 39397791
O'Reilly FJ, Graziadei A, Forbrig C, Bremenkamp R, Charles K, Lenz S, Elfmann C, Fischer L, Stülke J, Rappsilber JProtein complexes in cells by AI-assisted structural proteomics.Molecular systems biology. 2023 Feb 23; :e11544. PMID: 36815589
Guedon E, Moore CM, Que Q, Wang T, Ye RW, Helmann JD The global transcriptional response of Bacillus subtilis to manganese involves the MntR, Fur, TnrA and sigmaB regulons. Molecular microbiology. 2003 Sep; 49(6):1477-91. . PMID:12950915
Que Q, Helmann JD Manganese homeostasis in Bacillus subtilis is regulated by MntR, a bifunctional regulator related to the diphtheria toxin repressor family of proteins. Molecular microbiology. 2000 Mar; 35(6):1454-68. . PMID:10760146
Que Q, Helmann JD Manganese homeostasis in Bacillus subtilis is regulated by MntR, a bifunctional regulator related to the diphtheria toxin repressor family of proteins. Molecular microbiology. 2000 Mar; 35(6):1454-68. . PMID:10760146
Que Q, Helmann JD Manganese homeostasis in Bacillus subtilis is regulated by MntR, a bifunctional regulator related to the diphtheria toxin repressor family of proteins. Molecular microbiology. 2000 Mar; 35(6):1454-68. . PMID:10760146
Quentin Y, Fichant G, Denizot F Inventory, assembly and analysis of Bacillus subtilis ABC transport systems. Journal of molecular biology. 1999 Apr 02; 287(3):467-84. . PMID:10092453