pbuO

168

similar to hypoxanthine/guanine permease PbuG

Locus: BSU_29990

Molecular weight: 45.26 kDa

Isoelectric point: 7.48

Protein length: 432 aa

Gene length: 1299 bp

Function: unknown

Product: unknown

Essential: no

Synonyms: pbuO, ytiP

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Cellular processes, Transporters, Transporters/ other, Nucleotide/ nucleoside transporter

Metabolism, Nucleotide metabolism, Biosynthesis/ acquisition of nucleotides, Biosynthesis/ acquisition of purine nucleotides/ based on similarity

List of homologs in different organisms, belongs to COG2252 (Galperin et al., 2021)

This gene is a member of the following regulons

PurR regulon

Gene

Coordinates: 3,068,908  3,070,206

The protein

Protein family

xanthine/uracil permease family (according to UniProt)

Structure

O34978 (AlphaFold)

Paralogous protein(s)

PbuG

Expression and Regulation

Operons

Genes: pbuO

Description: PubMed

Regulation

repressed in the presence of purine nucleotides (PurR) PubMed

Regulatory mechanism

PurR: repression, (molecular inducer: PRPP) PubMed, in purR regulon

Biological materials

Mutant

MGNA-A819 (ytiP::erm), available at the NBRP B. subtilis, Japan
BKE29990 (pbuO::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAGTATCCTCCAATTACG,  downstream forward: _UP4_TAAGGATAGACCAAAAAACC
BKK29990 (pbuO::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAGTATCCTCCAATTACG,  downstream forward: _UP4_TAAGGATAGACCAAAAAACC

References

Saxild HH, Brunstedt K, Nielsen KI, Jarmer H, Nygaard P Definition of the Bacillus subtilis PurR operator using genetic and bioinformatic tools and expansion of the PurR regulon with glyA, guaC, pbuG, xpt-pbuX, yqhZ-folD, and pbuO. Journal of bacteriology. 2001 Nov; 183(21):6175-83. . PMID:11591660
Lapidus A, Galleron N, Sorokin A, Ehrlich SD Sequencing and functional annotation of the Bacillus subtilis genes in the 200 kb rrnB-dnaB region. Microbiology (Reading, England). 1997 Nov; 143 ( Pt 11):3431-41. . PMID:9387221
Ebbole DJ, Zalkin H Interaction of a putative repressor protein with an extended control region of the Bacillus subtilis pur operon. The Journal of biological chemistry. 1989 Feb 25; 264(6):3553-61. . PMID:2536750