malS

168

malate dehydrogenase (decarboxylating), forms a transhydrogenation cycle with YtsJ for balancing of NADPH

Locus: BSU_29880

Molecular weight: 61.98 kDa

Isoelectric point: 4.89

Protein length: 566 aa

Gene length: 1701 bp

Function: malate utilization

Product: malate dehydrogenase (decarboxylating)

Essential: no

E.C.: 1.1.1.38

Synonyms: malS

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Metabolism, Carbon metabolism, Utilization of specific carbon sources, Utilization of organic acids

List of homologs in different organisms, belongs to COG0281 (Galperin et al., 2021)

Gene

Coordinates: 3,056,849 → 3,058,549

The protein

Catalyzed reaction/ biological activity

(S)-malate + NAD+ --> CO₂ + NADH + pyruvate (according to UniProt)
H⁺ + oxaloacetate --> CO₂ + pyruvate (according to UniProt)

Protein family

malic enzymes family (according to UniProt)

Structure

1LLQ (PDB) (from Ascaris suum, 40% identity) PubMed
O34389 (AlphaFold)

Paralogous protein(s)

MaeA, YtsJ, MleA

Expression and Regulation

Operons

Genes: ytnP-malS

Description: PubMed

Genes: malS

Description: PubMed

Biological materials

Mutant

GP1142 (ΔmalS::spc) available in Jörg Stülke's lab
BKE29880 (ΔmalS::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACCCTGCCTCTTCCTTTCT,  downstream forward: _UP4_TAATAAAAAAGAGCCGCTGC
BKK29880 (ΔmalS::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACCCTGCCTCTTCCTTTCT,  downstream forward: _UP4_TAATAAAAAAGAGCCGCTGC

References

Swarge B, Nafid C, Vischer N, Kramer G, Setlow P, Brul SInvestigating Synthesis of the MalS Malic Enzyme during Bacillus subtilis Spore Germination and Outgrowth and the Influence of Spore Maturation and Sporulation Conditions.mSphere. 2020 Aug 5; 5(4). PMID: 32759333
Meyer FM, Stülke J Malate metabolism in Bacillus subtilis: distinct roles for three classes of malate-oxidizing enzymes. FEMS microbiology letters. 2013 Feb; 339(1):17-22. doi:10.1111/1574-6968.12041. PMID:23136871
Rühl M, Le Coq D, Aymerich S, Sauer U 13C-flux analysis reveals NADPH-balancing transhydrogenation cycles in stationary phase of nitrogen-starving Bacillus subtilis. The Journal of biological chemistry. 2012 Aug 10; 287(33):27959-70. doi:10.1074/jbc.M112.366492. PMID:22740702
Lerondel G, Doan T, Zamboni N, Sauer U, Aymerich S YtsJ has the major physiological role of the four paralogous malic enzyme isoforms in Bacillus subtilis. Journal of bacteriology. 2006 Jul; 188(13):4727-36. . PMID:16788182
Doan T, Servant P, Tojo S, Yamaguchi H, Lerondel G, Yoshida K, Fujita Y, Aymerich S The Bacillus subtilis ywkA gene encodes a malic enzyme and its transcription is activated by the YufL/YufM two-component system in response to malate. Microbiology (Reading, England). 2003 Sep; 149(Pt 9):2331-43. . PMID:12949160
Coleman DE, Rao GS, Goldsmith EJ, Cook PF, Harris BG Crystal structure of the malic enzyme from Ascaris suum complexed with nicotinamide adenine dinucleotide at 2.3 A resolution. Biochemistry. 2002 Jun 04; 41(22):6928-38. . PMID:12033925
Lapidus A, Galleron N, Sorokin A, Ehrlich SD Sequencing and functional annotation of the Bacillus subtilis genes in the 200 kb rrnB-dnaB region. Microbiology (Reading, England). 1997 Nov; 143 ( Pt 11):3431-41. . PMID:9387221