tcyJ

168

cystine and cysteinopantetheine ABC transporter (binding protein)

Locus: BSU_29380

Molecular weight: 30.02 kDa

Isoelectric point: 9.6

Protein length: 269 aa

Gene length: 810 bp

Function: cystine and cysteinopantetheine uptake

Product: cystine and cysteinopantetheine ABC transporter (binding protein)

Essential: no

Synonyms: tcyJ, ytmJ

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0834 (Galperin et al., 2021)

Gene

Coordinates: 3,007,426  3,008,235

The protein

Catalyzed reaction/ biological activity

• binding of cystine and cysteinopantetheine (for transport) PubMed

Protein family

• bacterial solute-binding protein 3 family (according to UniProt)

Structure

• 4GVO (PDB) (from Listeria monocytogenes, 57% identity)
• O34406 (AlphaFold)

Paralogous protein(s)

• TcyK

Localization

• attached to the membrane via TcyL-TcyM PubMed

Expression and Regulation

Operons

• Genes: snaA-tcyJ-tcyK-tcyL-tcyM-tcyN-cmoO-cmoI-cmoJ-ribR-sndA-ytnM

  Description: PubMed

  Regulation

  • induced in the presence of methionine and taurine PubMed

  Regulatory mechanism

  • CymR: repression, PubMed, in cymR regulon
  • AscR: activation, PubMed, in ascR regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon

Biological materials

Mutant

• GP4659 (trpC2 ΔtcyJ-tcyK-tcyL-tcyM-tcyN::tet), available in Jörg Stülke's lab PubMed
• MGNA-A170 (ytmJ::erm), available at the NBRP B. subtilis, Japan
• 1A948 ( tcyJ::kan), PubMed, available at BGSC
• BKE29380 (tcyJ::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_ACGCTTATTCATAGGCTGCC,  downstream forward: _UP4_TTTGAAAAATAAATGGGGCG
• BKK29380 (tcyJ::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_ACGCTTATTCATAGGCTGCC,  downstream forward: _UP4_TTTGAAAAATAAATGGGGCG

Expression system

• GP4687 (trpC2 xkdE::P_xyl-tcyJ-tcyK-tcyL-tcyM-tcyN-ermC), available in Jörg Stülke's lab

References

Loading