tcyJ

168

cystine and cysteinopantetheine ABC transporter (binding protein)

Locus: BSU_29380

Molecular weight: 30.02 kDa

Isoelectric point: 9.6

Protein length: 269 aa

Gene length: 810 bp

Function: cystine and cysteinopantetheine uptake

Product: cystine and cysteinopantetheine ABC transporter (binding protein)

Essential: no

Synonyms: tcyJ, ytmJ

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Cellular processes, Transporters, ABC transporters, Importers, Uptake of amino acids

Metabolism, Amino acid/ nitrogen metabolism, Biosynthesis/ acquisition of amino acids, Biosynthesis/ acquisition of cysteine

Groups of genes, Membrane proteins

List of homologs in different organisms, belongs to COG0834 (Galperin et al., 2021)

This gene is a member of the following regulons

SigA regulon, CymR regulon, AscR regulon

Gene

Coordinates: 3,007,426  3,008,235

The protein

Catalyzed reaction/ biological activity

binding of cystine and cysteinopantetheine (for transport) PubMed

Protein family

bacterial solute-binding protein 3 family (according to UniProt)

Structure

4GVO (PDB) (from Listeria monocytogenes, 57% identity)
O34406 (AlphaFold)

Paralogous protein(s)

TcyK

Localization

attached to the membrane via TcyL-TcyM PubMed

Expression and Regulation

Operons

Genes: snaA-tcyJ-tcyK-tcyL-tcyM-tcyN-cmoO-cmoI-cmoJ-ribR-sndA-ytnM

Description: PubMed

Regulation

induced in the presence of methionine and taurine PubMed

Regulatory mechanism

CymR: repression, PubMed, in cymR regulon
AscR: activation, PubMed, in ascR regulon

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon

Biological materials

Mutant

GP4659 (trpC2 ΔtcyJ-tcyK-tcyL-tcyM-tcyN::tet), available in Jörg Stülke's lab PubMed
MGNA-A170 (ytmJ::erm), available at the NBRP B. subtilis, Japan
1A948 ( tcyJ::kan), PubMed, available at BGSC
BKE29380 (tcyJ::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_ACGCTTATTCATAGGCTGCC,  downstream forward: _UP4_TTTGAAAAATAAATGGGGCG
BKK29380 (tcyJ::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_ACGCTTATTCATAGGCTGCC,  downstream forward: _UP4_TTTGAAAAATAAATGGGGCG

Expression system

GP4687 (trpC2 xkdE::P_xyl-tcyJ-tcyK-tcyL-tcyM-tcyN-ermC), available in Jörg Stülke's lab

References

Loading