tcyL

168

cystine and cysteinopantetheine ABC transporter (permease)

Locus: BSU_29360

Molecular weight: 26.09 kDa

Isoelectric point: 9.3

Protein length: 239 aa

Gene length: 720 bp

Function: cystine and cysteinopantetheine uptake

Product: cystine and cysteinopantetheine ABC transporter (permease)

Essential: no

Synonyms: tcyL, ytmL

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Cellular processes, Transporters, ABC transporters, Importers, Uptake of amino acids

Metabolism, Amino acid/ nitrogen metabolism, Biosynthesis/ acquisition of amino acids, Biosynthesis/ acquisition of cysteine

Groups of genes, Membrane proteins

List of homologs in different organisms, belongs to COG0765 (Galperin et al., 2021)

Gene

Coordinates: 3,005,859  3,006,578

The protein

Catalyzed reaction/ biological activity

uptake of cystine and cysteinopantetheine PubMed

Protein family

Binding-protein-dependent transport system permease family (according to UniProt)

Domains

ABC transmembrane type-1 domain (aa 21-216) (according to UniProt)

Structure

4YMS (PDB) (amino acid transporter from Caldanaerobacter subterraneus, 31% identity) PubMed
O34315 (AlphaFold)

Paralogous protein(s)

YxeN

Localization

cell membrane PubMed

Expression and Regulation

Operons

Genes: snaA-tcyJ-tcyK-tcyL-tcyM-tcyN-cmoO-cmoI-cmoJ-ribR-sndA-ytnM

Description: PubMed

Regulation

induced in the presence of methionine and taurine PubMed

Regulatory mechanism

CymR: repression, PubMed, in cymR regulon
AscR: activation, PubMed, in ascR regulon

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon

Biological materials

Mutant

GP4478 (trpC2 ΔtcyL::neo), available in Jörg Stülke's lab
GP4659 (trpC2 ΔtcyJ-tcyK-tcyL-tcyM-tcyN::tet), available in Jörg Stülke's lab PubMed
MGNA-A172 (ytmL::erm), available at the NBRP B. subtilis, Japan
1A948 ( tcyL::kan), PubMed, available at BGSC
BKE29360 (tcyL::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATCACTGCTCCCTCTCTTT,  downstream forward: _UP4_TGATATATTTCTTCGGATGA
BKK29360 (tcyL::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATCACTGCTCCCTCTCTTT,  downstream forward: _UP4_TGATATATTTCTTCGGATGA

Expression system

GP4687 (trpC2 xkdE::P_xyl-tcyJ-tcyK-tcyL-tcyM-tcyN-ermC), available in Jörg Stülke's lab

References

Loading