rqcU

168

ribosome quality control (RQC) upstream factor, senses collisions between stalled and translating ribosomes, splits stalled ribosomes and targets the nascent peptide for degradation by the ribosome quality control pathway

Locus: BSU_28580

Molecular weight: 87.23 kDa

Isoelectric point: 5.79

Protein length: 785 aa

Gene length: 2358 bp

Function: initiation of ribosome-associated translation quality control

Product: ribosome quality control (RQC) upstream factor

Essential: no

Synonyms: mutSB, yshD, mutS2

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1193 (Galperin et al., 2021)

Gene

Coordinates: 2,920,936 → 2,923,293

Phenotypes of a mutant

• hypersensitive to antibiotics that target ribosomes PubMed
• enhanced formation of rpsB or rpsE suppressor mutants after mitomycin treatment PubMed

The protein

Catalyzed reaction/ biological activity

• ATPase activity: ATP + H2O --> ADP + H+ + phosphate PubMed
• splits stalled ribosomes and targets the nascent peptide for degradation by the ribosome quality control pathway PubMed

Protein family

• DNA mismatch repair mutS family (with MutS, according to UniProt)

Domains

• MutS III/IV domain (aa 5 - 315) PubMed
• MutS V (ATPase) domain (aa 328 - 513) PubMed
• KOW domain (aa 635 - 685) PubMed
• Smr domain (aa 707-785) PubMed

Structure

• 7QV3 (PDB) (MutS2-collided disome complex) PubMed
• P94545 (AlphaFold)

Expression and Regulation

Operons

• Genes: zapA-yshB-polX-rqcU-yshE

  Description: PubMed

  Regulation

  • constitutively expressed PubMed

Biological materials

Mutant

• MGNA-B007 (yshD::erm), available at the NBRP B. subtilis, Japan
• 1A845 ( mutSB::cat), PubMed, available at BGSC
• 1A845 ( mutSB::cat), PubMed, available at BGSC
• BKE28580 (ΔrqcU::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACGATTGTGTGAGCCTCCT,  downstream forward: _UP4_CTAAAATAAAAGGGAGTATG
• BKK28580 (ΔrqcU::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACGATTGTGTGAGCCTCCT,  downstream forward: _UP4_CTAAAATAAAAGGGAGTATG

Labs working on this gene/protein

• Alessandra Albertini, University of Pavia, Italy homepage

References

Reviews

Loading

Original Publications

Loading