aadK

168

aminoglycoside 6-adenylyltransferase

Locus: BSU_26790

Molecular weight: 33.75 kDa

Isoelectric point: 4.76

Protein length: 284 aa

Gene length: 855 bp

Function: resistance to streptomycin

Product: aminoglycoside 6-adenylyltransferase

Essential: no

E.C.: null

Synonyms: aadK

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms

Gene

Coordinates: 2,735,682  2,736,536

The protein

Structure

• 2PBE (PDB)
• P17585 (AlphaFold)

Expression and Regulation

Operons

• Genes: aadK-bstE

  Description: PubMed

Biological materials

Mutant

• BKE26790 (aadK::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTACATGTTCCTCCGTTT,  downstream forward: _UP4_TGATAAGAATATAGGATTGT
• BKK26790 (aadK::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTACATGTTCCTCCGTTT,  downstream forward: _UP4_TGATAAGAATATAGGATTGT

References

Noguchi N, Sasatsu M, Kono M Genetic mapping in Bacillus subtilis 168 of the aadK gene which encodes aminoglycoside 6-adenylyltransferase. FEMS microbiology letters. 1993 Nov 15; 114(1):47-52. . PMID:8293959
Ohmiya K, Tanaka T, Noguchi N, O'Hara K, Kono M Nucleotide sequence of the chromosomal gene coding for the aminoglycoside 6-adenylyltransferase from Bacillus subtilis Marburg 168. Gene. 1989 May 30; 78(2):377-8. . PMID:2550327