yrdF

168

similar to ribonuclease inhibitor

Locus: BSU_26730

Molecular weight: 10.59 kDa

Isoelectric point: 3.94

Protein length: 91 aa

Gene length: 276 bp

Function: unknown

Product: unknown

Essential: no

Synonyms: yrdF

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Groups of genes, Poorly characterized/ putative enzymes

List of homologs in different organisms, belongs to COG2732 (Galperin et al., 2021)

Gene

Coordinates: 2,730,560 → 2,730,835

The protein

Protein family

barstar family (single member, according to UniProt)

Structure

1A19 (PDB) (from Bacillus amyloliquefaciens 49%identity)
O07938 (AlphaFold)

Biological materials

Mutant

BKE26730 (ΔyrdF::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTAGAAACTATGCCCTCC,  downstream forward: _UP4_TAGACTTTCTGTTTTGCGAA
BKK26730 (ΔyrdF::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTAGAAACTATGCCCTCC,  downstream forward: _UP4_TAGACTTTCTGTTTTGCGAA

LacZ fusion

pGP3807 (in pAC7), available in Jörg Stülke's lab PubMed

References

Nagler K, Krawczyk AO, De Jong A, Madela K, Hoffmann T, Laue M, Kuipers OP, Bremer E, Moeller R Identification of Differentially Expressed Genes during Bacillus subtilis Spore Outgrowth in High-Salinity Environments Using RNA Sequencing. Frontiers in microbiology. 2016; 7:1564. . PMID:27766092