phrE

168

response regulator aspartate phosphatase (RapE) regulator, control of the phosphorelay

Locus: BSU_25840

Molecular weight: 4.72 kDa

Isoelectric point: 8.86

Protein length: 44 aa

Gene length: 135 bp

Function: control of sporulation initiation

Product: phosphatase (RapE) regulator

Essential: no

E.C.: null

Synonyms: phrE

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Information processing, Regulation of gene expression, Transcription factors and their control, Control of two-component response regulators, Control of response regulators/ other

Information processing, Regulation of gene expression, phosphorelay, Other protein controlling the activity of the phosphorelay

Information processing, Regulation of gene expression, Quorum sensing

Lifestyles, Sporulation, phosphorelay, Other protein controlling the activity of the phosphorelay

Prophages and mobile genetic elements, Prophages, Skin element

Groups of genes, Short peptides

List of homologs in different organisms

This gene is a member of the following regulons

SigA regulon, CcpA regulon, CodY regulon, AbrB regulon, ComA regulon, SigH regulon

Gene

Coordinates: 2,660,330  2,660,464

The protein

Protein family

phr family (according to UniProt)

Structure

O32025 (AlphaFold)

Expression and Regulation

Operons

Genes: phrE

Description: PubMed

Regulation

repressed by glucose (10-fold) (CcpA) PubMed

Regulatory mechanism

CcpA: repression, in ccpA regulon
CodY: repression, PubMed, in codY regulon
AbrB: repression, PubMed, in abrB regulon
ComA: activation, in comA regulon

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon
SigH: sigma factor, PubMed, in sigH regulon

Genes: rapE-phrE

Description: PubMed

Regulation

repressed by glucose (10-fold) (CcpA) PubMed

Regulatory mechanism

CodY: repression, PubMed, in codY regulon
ComA: activation, in comA regulon

Biological materials

Mutant

BKE25840 (phrE::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_AACGGCGGATAAACTGATAA,  downstream forward: _UP4_TAATTCGATAAACAACATTA
BKK25840 (phrE::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_AACGGCGGATAAACTGATAA,  downstream forward: _UP4_TAATTCGATAAACAACATTA

References

Reviews

Loading

Original Publications

Loading