cccA

168

cytochrome c550

Locus: BSU_25190

Molecular weight: 12.63 kDa

Isoelectric point: 5.28

Protein length: 120 aa

Gene length: 363 bp

Function: respiration

Product: cytochrome c550

Essential: no

Synonyms: cccA

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG2010 (Galperin et al., 2021)

Gene

Coordinates: 2,599,523 → 2,599,885

The protein

Domains

• transmembrane domain at the N-terminus (aa 5 -25) PubMed

Cofactors

• heme c  PubMed

Structure

• P24469 (AlphaFold)

Localization

• cell membrane (outer side) PubMed

Expression and Regulation

Operons

• Genes: cccA

  Description: PubMed

  Regulation

  • carbon catabolite repression (CcpA) PubMed

  Regulatory mechanism

  • CcpA: repression, cre site overlaps -35 region of the promoter PubMed, in ccpA regulon
  • AbrB: repression, PubMed, in abrB regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon

  Additional information

  • the mRNA is very stable (half-life > 15 min) PubMed

Biological materials

Mutant

• BKE25190 (ΔcccA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTTCCCTTCCCCCTTTTT,  downstream forward: _UP4_TAAAAGAACTATTTTTCTCT
• BKK25190 (ΔcccA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTTCCCTTCCCCCTTTTT,  downstream forward: _UP4_TAAAAGAACTATTTTTCTCT

References

Reviews

Hederstedt LMolecular Biology of Bacillus subtilis Cytochromes anno 2020.Biochemistry. Biokhimiia. 2021 Jan; 86(1):8-21. PMID: 33705278

Original Publications

Picón Garrido GI, García García AP, González de la Vara L, Chagolla-López A, Gómez-Lojero C, Gutiérrez-Cirlos EBSeparation and analysis of Bacillus subtilis respiratory chain complexes.Journal of bioenergetics and biomembranes. 2022 Dec; 54(5-6):251-271. PMID: 36422766
García Montes de Oca LY, Cabellos Avelar T, Picón Garrido GI, Chagoya-López A, González de la Vara L, Delgado Buenrostro NL, Chirino-López YI, Gómez-Lojero C, Gutiérrez-Cirlos EB Cardiolipin deficiency causes a dissociation of the b 6 c:caa 3 megacomplex in B. subtilis membranes. Journal of bioenergetics and biomembranes. 2016 Aug; 48(4):451-67. doi:10.1007/s10863-016-9671-y. PMID:27503613
Marciniak BC, Pabijaniak M, de Jong A, Dűhring R, Seidel G, Hillen W, Kuipers OP High- and low-affinity cre boxes for CcpA binding in Bacillus subtilis revealed by genome-wide analysis. BMC genomics. 2012 Aug 17; 13:401. doi:10.1186/1471-2164-13-401. PMID:22900538
Marciniak BC, Pabijaniak M, de Jong A, Dűhring R, Seidel G, Hillen W, Kuipers OP High- and low-affinity cre boxes for CcpA binding in Bacillus subtilis revealed by genome-wide analysis. BMC genomics. 2012 Aug 17; 13:401. doi:10.1186/1471-2164-13-401. PMID:22900538
Nicolas P, Mäder U, Dervyn E, Rochat T, Leduc A, Pigeonneau N, Bidnenko E, Marchadier E, Hoebeke M, Aymerich S, Becher D, Bisicchia P, Botella E, Delumeau O, Doherty G, Denham EL, Fogg MJ, Fromion V, Goelzer A, Hansen A, Härtig E, Harwood CR, Homuth G, Jarmer H, Jules M, Klipp E, Le Chat L, Lecointe F, Lewis P, Liebermeister W, March A, Mars RA, Nannapaneni P, Noone D, Pohl S, Rinn B, Rügheimer F, Sappa PK, Samson F, Schaffer M, Schwikowski B, Steil L, Stülke J, Wiegert T, Devine KM, Wilkinson AJ, van Dijl JM, Hecker M, Völker U, Bessières P, Noirot P Condition-dependent transcriptome reveals high-level regulatory architecture in Bacillus subtilis. Science (New York, N.Y.). 2012 Mar 02; 335(6072):1103-6. doi:10.1126/science.1206848. PMID:22383849
Chumsakul O, Takahashi H, Oshima T, Hishimoto T, Kanaya S, Ogasawara N, Ishikawa S Genome-wide binding profiles of the Bacillus subtilis transition state regulator AbrB and its homolog Abh reveals their interactive role in transcriptional regulation. Nucleic acids research. 2011 Jan; 39(2):414-28. doi:10.1093/nar/gkq780. PMID:20817675
Hambraeus G, von Wachenfeldt C, Hederstedt L Genome-wide survey of mRNA half-lives in Bacillus subtilis identifies extremely stable mRNAs. Molecular genetics and genomics : MGG. 2003 Aug; 269(5):706-14. . PMID:12884008
Blencke HM, Homuth G, Ludwig H, Mäder U, Hecker M, Stülke J Transcriptional profiling of gene expression in response to glucose in Bacillus subtilis: regulation of the central metabolic pathways. Metabolic engineering. 2003 Apr; 5(2):133-49. . PMID:12850135
Monedero V, Boël G, Deutscher J Catabolite regulation of the cytochrome c550-encoding Bacillus subtilis cccA gene. Journal of molecular microbiology and biotechnology. 2001 Jul; 3(3):433-8. . PMID:11361075
Bengtsson J, Rivolta C, Hederstedt L, Karamata D Bacillus subtilis contains two small c-type cytochromes with homologous heme domains but different types of membrane anchors. The Journal of biological chemistry. 1999 Sep 10; 274(37):26179-84. . PMID:10473570
David PS, Morrison MR, Wong SL, Hill BC Expression, purification, and characterization of recombinant forms of membrane-bound cytochrome c-550nm from Bacillus subtilis. Protein expression and purification. 1999 Feb; 15(1):69-76. . PMID:10024472
von Wachenfeldt C, Hederstedt L Physico-chemical characterisation of membrane-bound and water-soluble forms of Bacillus subtilis cytochrome c-550. European journal of biochemistry. 1993 Mar 01; 212(2):499-509. . PMID:8383048
von Wachenfeldt C, Hederstedt L Bacillus subtilis holo-cytochrome c-550 can be synthesised in aerobic Escherichia coli. FEBS letters. 1990 Sep 17; 270(1-2):147-51. . PMID:2171986
von Wachenfeldt C, Hederstedt L Bacillus subtilis 13-kilodalton cytochrome c-550 encoded by cccA consists of a membrane-anchor and a heme domain. The Journal of biological chemistry. 1990 Aug 15; 265(23):13939-48. . PMID:2166045