mmgA

168

degradative acetoacetyl-CoA thiolase

Locus: BSU_24170

Molecular weight: 41.02 kDa

Isoelectric point: 5.9

Protein length: 393 aa

Gene length: 1182 bp

Function: mother cell metabolism, leucine utilization

Product: degradative acetoacetyl-CoA thiolase

Essential: no

E.C.: 2.3.1.9

Synonyms: mmgA, yqiL

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Metabolism, Amino acid/ nitrogen metabolism, Utilization of amino acids, Utilization of branched-chain amino acids

Lifestyles, Sporulation, Sporulation proteins, Sporulation proteins/ other

List of homologs in different organisms, belongs to COG0183 (Galperin et al., 2021)

This gene is a member of the following regulons

SigE regulon, CcpA regulon

Gene

Coordinates: 2,512,861  2,514,042

The protein

Catalyzed reaction/ biological activity

2 acetyl-CoA --> CoA + acetoacetyl-CoA  PubMed

Protein family

thiolase-like superfamily (according to UniProt)

Structure

3SS6 (PDB) (the protein of B. anthracis, 44% identity, 73% similarity)
P45855 (AlphaFold)

Paralogous protein(s)

YhfS, FadA

Expression and Regulation

Operons

Genes: mmgA-mmgB-mmgC-mmgD-mmgE-mmgF

Description: PubMed

Regulation

expressed early during sporulation in the mother cell (SigE) PubMed
strongly expressed during oligotrophic growth PubMed

Regulatory mechanism

CcpA: repression, PubMed, in ccpA regulon

Sigma factors

SigE: sigma factor, PubMed, in sigE regulon

Biological materials

Mutant

BKE24170 (mmgA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGGTTTCACCTCATTCAG,  downstream forward: _UP4_TAAAACATGATGAAAAAGGG
BKK24170 (mmgA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGGTTTCACCTCATTCAG,  downstream forward: _UP4_TAAAACATGATGAAAAAGGG

References

Hess BM, Xue J, Markillie LM, Taylor RC, Wiley HS, Ahring BK, Linggi B Coregulation of Terpenoid Pathway Genes and Prediction of Isoprene Production in Bacillus subtilis Using Transcriptomics. PloS one. 2013; 8(6):e66104. doi:10.1371/journal.pone.0066104. PMID:23840410
Hsiao TL, Revelles O, Chen L, Sauer U, Vitkup D Automatic policing of biochemical annotations using genomic correlations. Nature chemical biology. 2010 Jan; 6(1):34-40. doi:10.1038/nchembio.266. PMID:19935659
Reddick JJ, Williams JK The mmgA gene from Bacillus subtilis encodes a degradative acetoacetyl-CoA thiolase. Biotechnology letters. 2008 Jun; 30(6):1045-50. doi:10.1007/s10529-008-9642-4. PMID:18246303
Steil L, Serrano M, Henriques AO, Völker U Genome-wide analysis of temporally regulated and compartment-specific gene expression in sporulating cells of Bacillus subtilis. Microbiology (Reading, England). 2005 Feb; 151(Pt 2):399-420. . PMID:15699190
Bryan EM, Beall BW, Moran CP A sigma E dependent operon subject to catabolite repression during sporulation in Bacillus subtilis. Journal of bacteriology. 1996 Aug; 178(16):4778-86. . PMID:8759838